Incidental Mutation 'R2196:Cep55'
ID238391
Institutional Source Beutler Lab
Gene Symbol Cep55
Ensembl Gene ENSMUSG00000024989
Gene Namecentrosomal protein 55
Synonyms1200008O12Rik, 2700032M20Rik
MMRRC Submission 040198-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2196 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38055025-38074425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38069110 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 187 (Y187N)
Ref Sequence ENSEMBL: ENSMUSP00000127961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096096] [ENSMUST00000116506] [ENSMUST00000169673]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082712
Predicted Effect probably damaging
Transcript: ENSMUST00000096096
AA Change: Y187N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093802
Gene: ENSMUSG00000024989
AA Change: Y187N

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
coiled coil region 98 150 N/A INTRINSIC
Pfam:EABR 171 205 1.2e-22 PFAM
coiled coil region 229 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116506
AA Change: Y187N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112205
Gene: ENSMUSG00000024989
AA Change: Y187N

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
coiled coil region 98 150 N/A INTRINSIC
Pfam:EABR 171 205 1.2e-22 PFAM
coiled coil region 229 371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169673
AA Change: Y187N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127961
Gene: ENSMUSG00000024989
AA Change: Y187N

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
coiled coil region 98 150 N/A INTRINSIC
Pfam:EABR 171 204 8.6e-22 PFAM
coiled coil region 229 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Acvr2a A T 2: 48,870,312 T27S possibly damaging Het
Ankhd1 T A 18: 36,648,379 N2161K probably damaging Het
Apba3 A G 10: 81,271,708 Y350C probably damaging Het
Bnipl T A 3: 95,249,870 R47S possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cep112 G A 11: 108,570,361 E329K probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Csad T C 15: 102,187,593 N142D probably benign Het
Dars A T 1: 128,378,858 I195N probably damaging Het
Dmxl1 T A 18: 49,917,631 L2454Q probably benign Het
Emc1 A T 4: 139,366,530 E650D probably benign Het
Enam A G 5: 88,502,744 D704G probably damaging Het
Fat1 T A 8: 45,024,646 I2220N probably damaging Het
Fat4 T C 3: 38,981,417 S3073P probably benign Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Gcsh G A 8: 116,989,170 T58M possibly damaging Het
Ghrhr T C 6: 55,379,741 Y108H probably damaging Het
Gm13757 G A 2: 88,446,710 T76I probably benign Het
Gm5431 A T 11: 48,889,231 I566N probably damaging Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Grin2c G T 11: 115,250,666 S875R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Krt87 T C 15: 101,438,433 E113G probably damaging Het
Map4 A G 9: 110,071,048 E934G probably damaging Het
Mkx A G 18: 7,000,675 L89P probably damaging Het
Myo15 T A 11: 60,510,021 Y2982* probably null Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nom1 A G 5: 29,436,021 D353G probably benign Het
Notch1 A T 2: 26,463,804 L1937* probably null Het
Nrxn2 A T 19: 6,490,109 D820V probably damaging Het
Nup210 A T 6: 91,055,244 N47K probably benign Het
Olfr214 A T 6: 116,556,617 Q64L probably damaging Het
Olfr340 T A 2: 36,452,588 M1K probably null Het
Pcolce2 A T 9: 95,694,689 I338F probably damaging Het
Pkd1 T C 17: 24,580,072 M2755T possibly damaging Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Rab3a T C 8: 70,757,226 S51P probably benign Het
Scn10a G A 9: 119,609,004 A1933V probably benign Het
Serpina1c T A 12: 103,896,111 Y315F probably damaging Het
Slc29a4 A C 5: 142,712,895 I104L possibly damaging Het
Spag16 G A 1: 69,858,522 V144I possibly damaging Het
Spata22 A G 11: 73,345,834 K322R probably benign Het
Sult2a8 T A 7: 14,427,853 I23L probably benign Het
Thoc1 T A 18: 9,986,300 V344D probably damaging Het
Tnn G C 1: 160,097,228 Y1185* probably null Het
Trpc4 A G 3: 54,302,193 I660V probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Usp4 A G 9: 108,373,686 E531G probably benign Het
Vmn2r93 C T 17: 18,305,166 S362L probably damaging Het
Zfhx3 G T 8: 108,800,253 E927D probably damaging Het
Zfp644 A T 5: 106,638,603 M1K probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Cep55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cep55 APN 19 38073439 missense probably damaging 1.00
IGL02359:Cep55 APN 19 38069868 missense probably damaging 1.00
R0079:Cep55 UTSW 19 38060321 missense probably benign 0.04
R0308:Cep55 UTSW 19 38060211 missense possibly damaging 0.94
R0377:Cep55 UTSW 19 38071889 nonsense probably null
R0725:Cep55 UTSW 19 38060174 missense possibly damaging 0.48
R0736:Cep55 UTSW 19 38073317 missense probably benign 0.21
R1842:Cep55 UTSW 19 38057900 missense probably benign 0.09
R2227:Cep55 UTSW 19 38062634 missense probably benign 0.37
R3832:Cep55 UTSW 19 38053112 unclassified probably benign
R4936:Cep55 UTSW 19 38071754 splice site probably null
R4938:Cep55 UTSW 19 38069916 missense probably damaging 1.00
R5246:Cep55 UTSW 19 38069671 missense probably benign 0.39
R5628:Cep55 UTSW 19 38069948 nonsense probably null
R5774:Cep55 UTSW 19 38062655 missense probably damaging 1.00
R6708:Cep55 UTSW 19 38060261 missense probably benign 0.23
R6787:Cep55 UTSW 19 38057926 missense probably benign 0.01
R7047:Cep55 UTSW 19 38060091 missense possibly damaging 0.65
R7187:Cep55 UTSW 19 38060358 critical splice donor site probably null
R7473:Cep55 UTSW 19 38069936 missense probably damaging 0.99
X0023:Cep55 UTSW 19 38071867 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTCTCTGGAAACTGACTGTC -3'
(R):5'- TCACTCCTGTTGGGAAATGTCAG -3'

Sequencing Primer
(F):5'- CTCTGGAAACTGACTGTCATGTATTC -3'
(R):5'- GGGAAATGTCAGGCTTATCCC -3'
Posted On2014-10-02