Incidental Mutation 'R2197:Atxn2'
ID238406
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Nameataxin 2
Synonyms9630045M23Rik, ATX2, Sca2
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121711337-121816493 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 121806217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327]
Predicted Effect probably null
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160093
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161872
Predicted Effect probably benign
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199451
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1263 G A 2: 90,015,424 G165S probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121795055 missense probably benign 0.00
IGL00798:Atxn2 APN 5 121795235 missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121810979 missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121797344 missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121806268 nonsense probably null
IGL02122:Atxn2 APN 5 121778030 missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121781387 missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121781336 missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121810909 missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121785235 missense probably benign 0.00
R0387:Atxn2 UTSW 5 121802143 missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121772778 missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121747421 unclassified probably null
R1305:Atxn2 UTSW 5 121749184 missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121803082 critical splice donor site probably null
R1471:Atxn2 UTSW 5 121786374 missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121779591 missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121802108 missense probably damaging 0.99
R1528:Atxn2 UTSW 5 121813530 missense probably damaging 1.00
R2083:Atxn2 UTSW 5 121784006 missense probably benign 0.00
R2217:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121781393 missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121785868 critical splice donor site probably null
R4604:Atxn2 UTSW 5 121781343 missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121814411 missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121749096 missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121814343 missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121795035 unclassified probably null
R5213:Atxn2 UTSW 5 121814480 unclassified probably null
R5655:Atxn2 UTSW 5 121747426 missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121813449 missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121797310 missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121810992 missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121779432 missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121811614 critical splice donor site probably null
R6659:Atxn2 UTSW 5 121777964 missense probably benign 0.10
R6864:Atxn2 UTSW 5 121779494 missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121811467 nonsense probably null
X0028:Atxn2 UTSW 5 121802083 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGCCTTCCGGTTCAGTCC -3'
(R):5'- CTGAAAGAACTCAGTCTTTGATTCC -3'

Sequencing Primer
(F):5'- GGTTCAGTCCTGTTCGCTTGTAAATC -3'
(R):5'- GCCCAGACATGCATACTTTG -3'
Posted On2014-10-02