Incidental Mutation 'R0183:Bcl2'
ID23846
Institutional Source Beutler Lab
Gene Symbol Bcl2
Ensembl Gene ENSMUSG00000057329
Gene NameB cell leukemia/lymphoma 2
SynonymsD830018M01Rik, C430015F12Rik, Bcl-2
MMRRC Submission 038448-MU
Accession Numbers

MGI: 88138

Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R0183 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location106538178-106714274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106712562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 107 (R107C)
Ref Sequence ENSEMBL: ENSMUSP00000139856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112751] [ENSMUST00000189999]
Predicted Effect probably damaging
Transcript: ENSMUST00000112751
AA Change: R107C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108371
Gene: ENSMUSG00000057329
AA Change: R107C

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189999
AA Change: R107C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139856
Gene: ENSMUSG00000057329
AA Change: R107C

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show pleiotropic abnormalities including small size, increased postnatal mortality, polycystic kidneys, apoptotic involution of thymus and spleen, graying in the second hair follicle cycle, and reduced numbers of motor, sympathetic and sensory neurons. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(8) Gene trapped(2) Chemically induced(1)          

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Bcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Bcl2 APN 1 106712358 missense possibly damaging 0.95
IGL03076:Bcl2 APN 1 106543307 missense probably benign 0.24
Croce UTSW 1 106543281 missense probably damaging 1.00
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0083:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0086:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0107:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0217:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0219:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0346:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0347:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0348:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0361:Bcl2 UTSW 1 106712694 missense probably damaging 0.96
R0470:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0471:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0601:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0609:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0965:Bcl2 UTSW 1 106712291 missense probably benign 0.13
R1756:Bcl2 UTSW 1 106712392 missense probably damaging 1.00
R2764:Bcl2 UTSW 1 106712436 missense probably damaging 1.00
R4798:Bcl2 UTSW 1 106712608 missense possibly damaging 0.57
R4922:Bcl2 UTSW 1 106712646 missense probably benign 0.00
R6864:Bcl2 UTSW 1 106543281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTGAGATCAAAGCCCAGAC -3'
(R):5'- TTCCAGCCTGAGAGCAACCCAATG -3'

Sequencing Primer
(F):5'- GTTCAGGTACTCAGTCATCCACAG -3'
(R):5'- ACCCAATGCCCGCTGTG -3'
Posted On2013-04-16