Mutagenetix > Incidental Mutation

Incidental Mutation 'R2198:Cdh20'

238471

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

040200-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R2198 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 104875047 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000052078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062528]

AlphaFold

Q9Z0M3

Predicted Effect

probably null
Transcript: ENSMUST00000062528

SMART Domains

Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
CA	82	163	1.01e-15	SMART
CA	187	272	1.35e-30	SMART
CA	296	388	1.98e-14	SMART
CA	411	492	1.61e-23	SMART
CA	515	602	3.9e-13	SMART
transmembrane domain	620	642	N/A	INTRINSIC
Pfam:Cadherin_C	645	793	2.6e-49	PFAM

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1a	T	C	14: 66,875,385 (GRCm39)	I120T	probably damaging	Het
Akr1c21	C	T	13: 4,627,464 (GRCm39)	P186L	probably damaging	Het
Alpk2	T	C	18: 65,483,255 (GRCm39)	K251R	probably benign	Het
Ank2	T	C	3: 126,728,226 (GRCm39)	E789G	possibly damaging	Het
Bag3	AAAGG	AAAGGAAGG	7: 128,147,493 (GRCm39)		probably null	Het
Cacna2d4	T	C	6: 119,324,220 (GRCm39)		probably benign	Het
Carf	G	A	1: 60,180,643 (GRCm39)	R355H	probably damaging	Het
Celf6	G	T	9: 59,510,622 (GRCm39)	L169F	possibly damaging	Het
Cep295nl	A	T	11: 118,223,419 (GRCm39)	I475N	probably benign	Het
Chdh	T	A	14: 29,753,489 (GRCm39)	S133T	possibly damaging	Het
Cnot6l	C	T	5: 96,227,800 (GRCm39)	D478N	possibly damaging	Het
Ctnna3	C	A	10: 64,838,524 (GRCm39)	T867K	probably benign	Het
Ctse	T	G	1: 131,600,185 (GRCm39)	Y311*	probably null	Het
Ddx60	T	A	8: 62,411,097 (GRCm39)	M453K	possibly damaging	Het
Dnah9	A	G	11: 65,750,325 (GRCm39)	F3927L	possibly damaging	Het
Dsg4	T	C	18: 20,594,499 (GRCm39)	S543P	probably benign	Het
Dspp	A	T	5: 104,323,567 (GRCm39)	T237S	probably benign	Het
Eml6	T	G	11: 29,800,935 (GRCm39)	H357P	probably benign	Het
Epha3	T	C	16: 63,664,507 (GRCm39)	I38V	possibly damaging	Het
Erap1	C	T	13: 74,794,806 (GRCm39)	T155I	probably damaging	Het
Erh	T	C	12: 80,689,559 (GRCm39)		probably benign	Het
F5	A	T	1: 164,034,603 (GRCm39)	K1834M	probably damaging	Het
Fyn	A	G	10: 39,405,541 (GRCm39)	E269G	probably benign	Het
Gm4884	A	G	7: 40,690,229 (GRCm39)	T42A	probably benign	Het
Grm1	T	G	10: 10,658,520 (GRCm39)	R323S	probably damaging	Het
Gstt4	T	C	10: 75,658,235 (GRCm39)	D8G	probably damaging	Het
Gvin-ps3	T	A	7: 105,682,758 (GRCm39)	M166L	probably benign	Het
Ldlr	A	G	9: 21,643,698 (GRCm39)	D94G	probably damaging	Het
Mrpl54	G	A	10: 81,101,575 (GRCm39)		probably null	Het
Naip2	A	T	13: 100,289,100 (GRCm39)	F1210Y	probably damaging	Het
Nifk	A	G	1: 118,257,130 (GRCm39)	R88G	probably benign	Het
Nlgn1	C	T	3: 25,487,925 (GRCm39)	M803I	probably damaging	Het
Or2r11	A	G	6: 42,437,950 (GRCm39)	M1T	probably null	Het
Or2y16	C	T	11: 49,334,786 (GRCm39)	S36F	probably benign	Het
Or6c88	T	A	10: 129,406,915 (GRCm39)	Y130*	probably null	Het
Or8g18	G	A	9: 39,149,048 (GRCm39)	T224I	possibly damaging	Het
Pip4k2a	A	T	2: 18,852,466 (GRCm39)	M272K	probably damaging	Het
Ppp1cb	G	T	5: 32,640,704 (GRCm39)	C139F	probably damaging	Het
Rad23b	G	A	4: 55,385,497 (GRCm39)	G345R	possibly damaging	Het
Shc4	A	T	2: 125,481,266 (GRCm39)	V548E	possibly damaging	Het
Slc26a9	A	G	1: 131,691,001 (GRCm39)		probably benign	Het
Slc8a1	T	A	17: 81,715,685 (GRCm39)	K783*	probably null	Het
Sobp	A	C	10: 42,898,520 (GRCm39)	I355S	possibly damaging	Het
Thbs4	A	G	13: 92,899,779 (GRCm39)	Y491H	possibly damaging	Het
Tle2	T	C	10: 81,426,147 (GRCm39)	V727A	probably damaging	Het
Tmprss9	C	T	10: 80,723,293 (GRCm39)	P251L	probably damaging	Het
Tnks	A	T	8: 35,315,803 (GRCm39)	D994E	probably benign	Het
Tnks	C	T	8: 35,340,221 (GRCm39)	D466N	probably benign	Het
Tonsl	A	G	15: 76,520,872 (GRCm39)	F394L	probably benign	Het
Trpa1	T	A	1: 14,980,970 (GRCm39)	Y144F	probably benign	Het
Usp22	A	G	11: 61,050,163 (GRCm39)	F324S	probably damaging	Het
Vmn1r78	G	T	7: 11,886,487 (GRCm39)	V33F	probably benign	Het
Wdr81	C	T	11: 75,336,907 (GRCm39)	R1494Q	probably benign	Het
Wdr87-ps	G	T	7: 29,226,697 (GRCm39)		noncoding transcript	Het
Zc3h14	G	A	12: 98,719,068 (GRCm39)	M144I	probably damaging	Het
Zc3h14	G	A	12: 98,719,069 (GRCm39)	V145M	possibly damaging	Het
Zfp82	T	C	7: 29,756,936 (GRCm39)	T49A	probably benign	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2068:Cdh20	UTSW	1	110,065,666 (GRCm39)	nonsense	probably null
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5196:Cdh20	UTSW	1	110,065,730 (GRCm39)	missense	probably damaging	0.99
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5496:Cdh20	UTSW	1	109,976,647 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7532:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104,869,004 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8022:Cdh20	UTSW	1	109,988,838 (GRCm39)	missense	probably benign	0.02
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104,898,583 (GRCm39)	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTTCTCACTACTCTGAAGG -3'
(R):5'- TGCCAACTTGGAAGTTTTGGTC -3'

Sequencing Primer
(F):5'- ACCTGCCTTATTCTTTAGGTTCAGAG -3'
(R):5'- AGGTCCTTGGCAAACACT -3'

Posted On

2014-10-02