Incidental Mutation 'R2198:Pip4k2a'
ID238476
Institutional Source Beutler Lab
Gene Symbol Pip4k2a
Ensembl Gene ENSMUSG00000026737
Gene Namephosphatidylinositol-5-phosphate 4-kinase, type II, alpha
SynonymsPip5k2a
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18842255-18998126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18847655 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 272 (M272K)
Ref Sequence ENSEMBL: ENSMUSP00000006912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006912] [ENSMUST00000148583]
Predicted Effect probably damaging
Transcript: ENSMUST00000006912
AA Change: M272K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006912
Gene: ENSMUSG00000026737
AA Change: M272K

DomainStartEndE-ValueType
PIPKc 62 405 1.19e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148583
SMART Domains Protein: ENSMUSP00000115475
Gene: ENSMUSG00000026737

DomainStartEndE-ValueType
Pfam:PIP5K 1 73 3.6e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152981
AA Change: M161K
SMART Domains Protein: ENSMUSP00000119075
Gene: ENSMUSG00000026737
AA Change: M161K

DomainStartEndE-ValueType
Pfam:PIP5K 18 198 1.4e-43 PFAM
Meta Mutation Damage Score 0.522 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Pip4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Pip4k2a APN 2 18872336 missense probably benign 0.10
IGL01682:Pip4k2a APN 2 18997968 missense probably benign
IGL02379:Pip4k2a APN 2 18866111 critical splice donor site probably null
R0096:Pip4k2a UTSW 2 18889039 splice site probably benign
R0184:Pip4k2a UTSW 2 18889128 missense probably damaging 0.96
R0514:Pip4k2a UTSW 2 18845936 missense probably damaging 0.99
R1673:Pip4k2a UTSW 2 18872282 critical splice donor site probably null
R1779:Pip4k2a UTSW 2 18847622 missense probably benign 0.27
R4555:Pip4k2a UTSW 2 18872292 missense probably damaging 0.99
R5408:Pip4k2a UTSW 2 18906308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGATCAAACTCTCCAGGAGC -3'
(R):5'- GAGGCCAGCTTTGCATTTGC -3'

Sequencing Primer
(F):5'- AACTCTCCAGGAGCCAAGGG -3'
(R):5'- TGGAATGATCTTAGCACTGAGC -3'
Posted On2014-10-02