Incidental Mutation 'R2198:Rad23b'
ID238480
Institutional Source Beutler Lab
Gene Symbol Rad23b
Ensembl Gene ENSMUSG00000028426
Gene NameRAD23 homolog B, nucleotide excision repair protein
Synonyms0610007D13Rik, mHR23B
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location55350043-55392237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55385497 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 345 (G345R)
Ref Sequence ENSEMBL: ENSMUSP00000030134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030134]
PDB Structure
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030134
AA Change: G345R

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426
AA Change: G345R

DomainStartEndE-ValueType
UBQ 1 75 8.79e-24 SMART
low complexity region 79 143 N/A INTRINSIC
UBA 190 227 3.1e-11 SMART
low complexity region 257 270 N/A INTRINSIC
STI1 274 317 3.37e-10 SMART
UBA 373 410 6.35e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156263
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Rad23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rad23b APN 4 55366774 splice site probably benign
IGL01326:Rad23b APN 4 55383601 missense possibly damaging 0.95
IGL02398:Rad23b APN 4 55350360 utr 5 prime probably benign
IGL02506:Rad23b APN 4 55382511 missense probably benign 0.01
IGL02538:Rad23b APN 4 55370457 missense possibly damaging 0.67
Saguaro UTSW 4 55370474 critical splice donor site probably null
R0278:Rad23b UTSW 4 55383575 splice site probably null
R1846:Rad23b UTSW 4 55383637 nonsense probably null
R2425:Rad23b UTSW 4 55385438 missense probably damaging 0.99
R3774:Rad23b UTSW 4 55382589 missense possibly damaging 0.95
R3781:Rad23b UTSW 4 55382586 missense probably damaging 1.00
R4197:Rad23b UTSW 4 55385455 missense probably damaging 0.98
R5911:Rad23b UTSW 4 55370474 critical splice donor site probably null
R6056:Rad23b UTSW 4 55382540 missense probably benign 0.01
R6067:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6078:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6079:Rad23b UTSW 4 55370400 missense probably damaging 0.97
U15987:Rad23b UTSW 4 55370400 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATCATTTACCTTTCAGAACTGTTGTG -3'
(R):5'- TGGTAGCAGGAGCCACTAGC -3'

Sequencing Primer
(F):5'- CTGGAATTAAAGTGTGACTCCCCG -3'
(R):5'- AGCCACTAGCCCAGGTG -3'
Posted On2014-10-02