Incidental Mutation 'R2198:Grm1'
ID238501
Institutional Source Beutler Lab
Gene Symbol Grm1
Ensembl Gene ENSMUSG00000019828
Gene Nameglutamate receptor, metabotropic 1
SynonymsGrm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R2198 (G1)
Quality Score198
Status Validated
Chromosome10
Chromosomal Location10686059-11082356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10782776 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 323 (R323S)
Ref Sequence ENSEMBL: ENSMUSP00000101190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]
Predicted Effect probably damaging
Transcript: ENSMUST00000044306
AA Change: R323S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: R323S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 1.1e-94 PFAM
Pfam:Peripla_BP_6 151 340 1.4e-10 PFAM
Pfam:NCD3G 521 571 5.5e-16 PFAM
Pfam:7tm_3 604 837 2.4e-55 PFAM
low complexity region 969 975 N/A INTRINSIC
low complexity region 983 993 N/A INTRINSIC
low complexity region 1013 1033 N/A INTRINSIC
low complexity region 1071 1088 N/A INTRINSIC
low complexity region 1093 1109 N/A INTRINSIC
low complexity region 1126 1136 N/A INTRINSIC
GluR_Homer-bdg 1149 1199 6.85e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105560
AA Change: R323S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: R323S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105561
AA Change: R323S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: R323S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 77 485 2e-92 PFAM
Pfam:Peripla_BP_6 152 347 2.7e-12 PFAM
Pfam:NCD3G 520 571 2.7e-19 PFAM
Pfam:7tm_3 602 838 3.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220108
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Grm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Grm1 APN 10 10720039 missense probably benign 0.01
IGL02078:Grm1 APN 10 10689610 missense probably benign 0.02
IGL02156:Grm1 APN 10 10719976 missense probably damaging 0.99
IGL02476:Grm1 APN 10 10689453 missense probably benign 0.29
IGL02498:Grm1 APN 10 10719979 missense probably damaging 1.00
IGL02621:Grm1 APN 10 10689011 nonsense probably null
IGL03192:Grm1 APN 10 11079916 missense possibly damaging 0.66
IGL03342:Grm1 APN 10 11079971 missense probably benign 0.08
dewey UTSW 10 10719595 missense probably damaging 1.00
dingus UTSW 10 10719967 missense probably benign 0.06
donald UTSW 10 10741508 nonsense probably null
jim UTSW 10 10719805 missense probably damaging 1.00
lightness UTSW 10 11079958 missense probably damaging 1.00
IGL02796:Grm1 UTSW 10 10689667 missense probably benign
R0294:Grm1 UTSW 10 11080399 missense probably damaging 1.00
R0525:Grm1 UTSW 10 10719209 splice site probably benign
R0554:Grm1 UTSW 10 10719923 missense probably benign 0.01
R1184:Grm1 UTSW 10 10720034 missense probably benign 0.40
R1319:Grm1 UTSW 10 10689398 missense probably benign 0.05
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1403:Grm1 UTSW 10 11080135 missense probably benign 0.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1467:Grm1 UTSW 10 10719958 missense probably damaging 1.00
R1494:Grm1 UTSW 10 10689706 missense probably benign 0.04
R1589:Grm1 UTSW 10 10719967 missense probably benign 0.06
R1615:Grm1 UTSW 10 10741508 nonsense probably null
R1720:Grm1 UTSW 10 10746794 splice site probably null
R1738:Grm1 UTSW 10 10936419 missense probably damaging 1.00
R1763:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R1774:Grm1 UTSW 10 11079866 missense possibly damaging 0.47
R2041:Grm1 UTSW 10 10746603 missense probably damaging 0.98
R2092:Grm1 UTSW 10 10689225 missense probably benign 0.00
R2297:Grm1 UTSW 10 11080414 missense probably benign 0.03
R2333:Grm1 UTSW 10 10719346 missense probably damaging 0.98
R2333:Grm1 UTSW 10 10719619 missense probably benign 0.31
R2914:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3105:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3106:Grm1 UTSW 10 11079857 missense probably benign 0.07
R3705:Grm1 UTSW 10 10782729 missense possibly damaging 0.95
R3931:Grm1 UTSW 10 10719878 missense probably benign 0.44
R4810:Grm1 UTSW 10 10782694 missense probably damaging 1.00
R4892:Grm1 UTSW 10 10719587 missense possibly damaging 0.81
R4938:Grm1 UTSW 10 10936513 missense probably damaging 1.00
R4947:Grm1 UTSW 10 10782633 missense probably damaging 1.00
R4966:Grm1 UTSW 10 10719665 nonsense probably null
R5152:Grm1 UTSW 10 11079875 missense probably benign 0.13
R5283:Grm1 UTSW 10 10733192 missense possibly damaging 0.70
R5317:Grm1 UTSW 10 10746699 missense possibly damaging 0.77
R5374:Grm1 UTSW 10 11080442 missense probably benign 0.14
R5428:Grm1 UTSW 10 10719563 missense probably damaging 1.00
R5604:Grm1 UTSW 10 10746735 missense probably damaging 1.00
R5894:Grm1 UTSW 10 11080255 missense probably damaging 1.00
R5896:Grm1 UTSW 10 11080550 utr 5 prime probably benign
R5899:Grm1 UTSW 10 10689348 missense probably benign
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6032:Grm1 UTSW 10 10719805 missense probably damaging 1.00
R6139:Grm1 UTSW 10 10746331 intron probably benign
R6144:Grm1 UTSW 10 11079896 missense probably benign 0.08
R6208:Grm1 UTSW 10 10719946 missense probably damaging 1.00
R6976:Grm1 UTSW 10 10689180 missense probably benign 0.00
R7027:Grm1 UTSW 10 10719595 missense probably damaging 1.00
R7079:Grm1 UTSW 10 11079958 missense probably damaging 1.00
R7286:Grm1 UTSW 10 10689696 missense probably benign 0.19
R7352:Grm1 UTSW 10 10719493 missense probably damaging 1.00
X0002:Grm1 UTSW 10 10936513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCCAAGAGGTGTCCAGG -3'
(R):5'- CAAATACACATGCAAGAGGTTCTC -3'

Sequencing Primer
(F):5'- TGTCCAGGTAGGCGACACTG -3'
(R):5'- CCACAACTCTTTCTTGTCTAGTAAGG -3'
Posted On2014-10-02