Incidental Mutation 'R2198:Ctnna3'
ID238505
Institutional Source Beutler Lab
Gene Symbol Ctnna3
Ensembl Gene ENSMUSG00000060843
Gene Namecatenin (cadherin associated protein), alpha 3
SynonymsCatna3, Vr22, alphaT-catenin, 4930429L08Rik
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63430098-65003667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65002745 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 867 (T867K)
Ref Sequence ENSEMBL: ENSMUSP00000101081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably benign
Transcript: ENSMUST00000075099
AA Change: T867K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843
AA Change: T867K

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105440
AA Change: T867K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843
AA Change: T867K

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105441
AA Change: T867K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843
AA Change: T867K

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased heart weight, increased ventricle size, dilated cardiomyopathy and increased susceptibility to ischemia-induced arrhythmias and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Ctnna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ctnna3 APN 10 63566833 missense probably damaging 1.00
IGL00823:Ctnna3 APN 10 63537543 missense possibly damaging 0.68
IGL00963:Ctnna3 APN 10 64945949 missense probably damaging 1.00
IGL01388:Ctnna3 APN 10 63504107 missense possibly damaging 0.67
IGL01655:Ctnna3 APN 10 64873170 missense probably benign 0.01
IGL01783:Ctnna3 APN 10 63820469 missense possibly damaging 0.91
IGL01909:Ctnna3 APN 10 63504131 missense probably benign 0.11
IGL02160:Ctnna3 APN 10 64250698 missense probably benign
IGL02267:Ctnna3 APN 10 64945998 missense probably benign 0.20
IGL02524:Ctnna3 APN 10 64260826 missense possibly damaging 0.68
IGL02707:Ctnna3 APN 10 63504065 missense probably benign
IGL03165:Ctnna3 APN 10 64945941 missense probably damaging 0.98
bipolar UTSW 10 64873207 missense probably damaging 0.96
catatonia UTSW 10 64585995 missense probably benign
hebephrenia UTSW 10 64260935 missense probably benign 0.17
PIT4687001:Ctnna3 UTSW 10 64834606 missense probably damaging 1.00
R0345:Ctnna3 UTSW 10 63566840 missense probably benign 0.00
R0387:Ctnna3 UTSW 10 64586130 missense probably benign 0.00
R0523:Ctnna3 UTSW 10 64675909 missense probably damaging 0.97
R0647:Ctnna3 UTSW 10 63820424 missense probably benign 0.00
R0676:Ctnna3 UTSW 10 64409261 missense probably benign 0.20
R1102:Ctnna3 UTSW 10 64585995 missense probably benign
R1521:Ctnna3 UTSW 10 64959842 missense probably benign 0.22
R1700:Ctnna3 UTSW 10 63852772 missense probably damaging 1.00
R1874:Ctnna3 UTSW 10 63504107 missense possibly damaging 0.67
R1995:Ctnna3 UTSW 10 63820364 missense probably damaging 0.98
R2088:Ctnna3 UTSW 10 64873207 missense probably damaging 0.96
R4056:Ctnna3 UTSW 10 65002568 missense probably damaging 1.00
R4208:Ctnna3 UTSW 10 64959778 missense probably benign 0.22
R4440:Ctnna3 UTSW 10 64260935 missense probably benign 0.17
R4568:Ctnna3 UTSW 10 63852809 missense possibly damaging 0.56
R4594:Ctnna3 UTSW 10 64586079 missense probably benign 0.32
R4835:Ctnna3 UTSW 10 63581944 missense probably benign 0.01
R4849:Ctnna3 UTSW 10 64873315 missense probably damaging 1.00
R5682:Ctnna3 UTSW 10 64873306 missense probably damaging 0.96
R5777:Ctnna3 UTSW 10 64675885 missense probably benign
R6414:Ctnna3 UTSW 10 64260865 missense probably benign 0.35
R7210:Ctnna3 UTSW 10 64250768 missense probably damaging 1.00
R7220:Ctnna3 UTSW 10 64834589 missense probably benign 0.04
Z1088:Ctnna3 UTSW 10 63581978 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGTTGGACAGTGTCACCTCC -3'
(R):5'- TGTGAGCTTAACTCTGAAACTTGG -3'

Sequencing Primer
(F):5'- GGACAGTGTCACCTCCCTGATC -3'
(R):5'- TGGTGAAATTAAAGAACCAATGAACC -3'
Posted On2014-10-02