Incidental Mutation 'R2200:Qser1'
ID238588
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Nameglutamine and serine rich 1
Synonyms4732486I23Rik
MMRRC Submission 040202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R2200 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104754795-104816760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104789013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 485 (S485P)
Ref Sequence ENSEMBL: ENSMUSP00000155882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117237
AA Change: S395P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994
AA Change: S395P

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231375
AA Change: S485P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,958,423 I135M probably benign Het
Ano7 A G 1: 93,380,436 E63G possibly damaging Het
Asah1 A G 8: 41,343,728 probably null Het
B3gat2 C T 1: 23,762,792 P53L probably benign Het
Bmp8b A T 4: 123,123,022 M339L possibly damaging Het
Bpifb9b C A 2: 154,313,654 Q358K probably benign Het
Cbs T C 17: 31,624,264 D231G probably damaging Het
Chd6 A G 2: 160,983,753 Y1144H probably damaging Het
Clca3a2 T A 3: 144,813,924 I230L probably benign Het
Clec2d A T 6: 129,184,868 T155S possibly damaging Het
Cpxm1 G T 2: 130,393,197 F567L probably damaging Het
Cyp4f16 G T 17: 32,537,104 A36S probably damaging Het
Dnah17 T C 11: 118,102,409 probably benign Het
Eml5 T C 12: 98,825,417 D1280G probably damaging Het
Ergic1 C A 17: 26,641,592 A218D possibly damaging Het
Eva1a A G 6: 82,091,913 R74G probably benign Het
Fam160a1 A G 3: 85,730,321 S224P probably damaging Het
Fus T A 7: 127,977,228 N273K probably damaging Het
Ipo13 A C 4: 117,904,903 probably null Het
Itgb3 T A 11: 104,640,986 probably null Het
Lrif1 T A 3: 106,734,558 S63R probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Lrp1b A T 2: 41,284,165 N1547K probably benign Het
Mme A T 3: 63,380,292 N738I possibly damaging Het
Morc2a A G 11: 3,683,919 N677S probably benign Het
Mrpl35 A C 6: 71,817,739 L82V probably benign Het
Mybpc1 A T 10: 88,555,695 N313K probably damaging Het
Podn T C 4: 108,022,590 D66G probably damaging Het
Ptpru A T 4: 131,820,813 N52K probably damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Rbm46 A T 3: 82,864,044 D421E probably benign Het
Rgs10 T C 7: 128,389,037 E109G probably damaging Het
Samd8 C T 14: 21,775,320 P178S probably benign Het
Scaf11 T C 15: 96,420,523 K387E probably damaging Het
Sccpdh G T 1: 179,670,606 V72F possibly damaging Het
Sec22a A T 16: 35,314,157 V285E probably damaging Het
Slc19a3 A G 1: 83,022,943 S118P probably damaging Het
Sun1 C A 5: 139,231,219 R338S probably benign Het
Taf1c A G 8: 119,598,678 F815S probably benign Het
Zcchc14 A T 8: 121,605,428 probably benign Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104766056 missense probably damaging 1.00
IGL00402:Qser1 APN 2 104786981 missense probably benign 0.00
IGL00417:Qser1 APN 2 104786903 missense probably damaging 1.00
IGL00756:Qser1 APN 2 104787671 missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104787631 missense probably damaging 0.99
IGL01317:Qser1 APN 2 104786979 missense probably damaging 0.99
IGL02186:Qser1 APN 2 104788261 missense probably damaging 1.00
IGL03236:Qser1 APN 2 104786532 missense probably benign 0.35
IGL03365:Qser1 APN 2 104786999 missense probably damaging 1.00
behoove UTSW 2 104786977 nonsense probably null
I1329:Qser1 UTSW 2 104786977 nonsense probably null
R0270:Qser1 UTSW 2 104788961 missense probably benign 0.03
R0395:Qser1 UTSW 2 104762881 missense probably damaging 1.00
R0523:Qser1 UTSW 2 104789676 missense probably damaging 1.00
R0727:Qser1 UTSW 2 104777311 splice site probably benign
R1037:Qser1 UTSW 2 104760555 missense probably damaging 0.99
R1222:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1418:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1891:Qser1 UTSW 2 104790099 missense probably benign
R1974:Qser1 UTSW 2 104760541 missense probably damaging 1.00
R4179:Qser1 UTSW 2 104776384 missense probably benign 0.19
R4379:Qser1 UTSW 2 104766059 splice site probably null
R4418:Qser1 UTSW 2 104789421 missense probably damaging 1.00
R4585:Qser1 UTSW 2 104786793 missense probably benign 0.01
R4697:Qser1 UTSW 2 104787183 missense probably benign 0.00
R4749:Qser1 UTSW 2 104787304 missense probably benign 0.16
R4775:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R5010:Qser1 UTSW 2 104787831 missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104787282 missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104787431 missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104786642 missense probably damaging 1.00
R5400:Qser1 UTSW 2 104789874 missense probably damaging 1.00
R5502:Qser1 UTSW 2 104786574 missense probably benign 0.00
R5615:Qser1 UTSW 2 104789694 missense possibly damaging 0.78
R5664:Qser1 UTSW 2 104778196 missense probably damaging 1.00
R5750:Qser1 UTSW 2 104788923 missense probably damaging 1.00
R5793:Qser1 UTSW 2 104762860 missense probably damaging 1.00
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6171:Qser1 UTSW 2 104789283 missense probably damaging 1.00
R6223:Qser1 UTSW 2 104787648 missense probably benign 0.01
R6254:Qser1 UTSW 2 104790090 missense probably benign 0.07
R6303:Qser1 UTSW 2 104762830 missense probably damaging 1.00
R6653:Qser1 UTSW 2 104780260 missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104777325 missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104788130 missense probably benign 0.25
T0722:Qser1 UTSW 2 104786832 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GAAACTGGCAAGCTCTGACC -3'
(R):5'- TGCCATCTATTGTTCATTCACAGG -3'

Sequencing Primer
(F):5'- AAGCTCTGACCCCGAGAG -3'
(R):5'- TCACAGGTTTATAGGTCCAGCAG -3'
Posted On2014-10-02