Incidental Mutation 'R2200:Bpifb9b'
ID238590
Institutional Source Beutler Lab
Gene Symbol Bpifb9b
Ensembl Gene ENSMUSG00000067996
Gene NameBPI fold containing family B, member 9B
SynonymsOTTMUSG00000015915, 5430413K10Rik
MMRRC Submission 040202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R2200 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154307227-154320646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154313654 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 358 (Q358K)
Ref Sequence ENSEMBL: ENSMUSP00000086311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088921]
Predicted Effect probably benign
Transcript: ENSMUST00000088921
AA Change: Q358K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000086311
Gene: ENSMUSG00000067996
AA Change: Q358K

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
low complexity region 167 181 N/A INTRINSIC
low complexity region 184 203 N/A INTRINSIC
Pfam:LBP_BPI_CETP 216 377 1.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,958,423 I135M probably benign Het
Ano7 A G 1: 93,380,436 E63G possibly damaging Het
Asah1 A G 8: 41,343,728 probably null Het
B3gat2 C T 1: 23,762,792 P53L probably benign Het
Bmp8b A T 4: 123,123,022 M339L possibly damaging Het
Cbs T C 17: 31,624,264 D231G probably damaging Het
Chd6 A G 2: 160,983,753 Y1144H probably damaging Het
Clca3a2 T A 3: 144,813,924 I230L probably benign Het
Clec2d A T 6: 129,184,868 T155S possibly damaging Het
Cpxm1 G T 2: 130,393,197 F567L probably damaging Het
Cyp4f16 G T 17: 32,537,104 A36S probably damaging Het
Dnah17 T C 11: 118,102,409 probably benign Het
Eml5 T C 12: 98,825,417 D1280G probably damaging Het
Ergic1 C A 17: 26,641,592 A218D possibly damaging Het
Eva1a A G 6: 82,091,913 R74G probably benign Het
Fam160a1 A G 3: 85,730,321 S224P probably damaging Het
Fus T A 7: 127,977,228 N273K probably damaging Het
Ipo13 A C 4: 117,904,903 probably null Het
Itgb3 T A 11: 104,640,986 probably null Het
Lrif1 T A 3: 106,734,558 S63R probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Lrp1b A T 2: 41,284,165 N1547K probably benign Het
Mme A T 3: 63,380,292 N738I possibly damaging Het
Morc2a A G 11: 3,683,919 N677S probably benign Het
Mrpl35 A C 6: 71,817,739 L82V probably benign Het
Mybpc1 A T 10: 88,555,695 N313K probably damaging Het
Podn T C 4: 108,022,590 D66G probably damaging Het
Ptpru A T 4: 131,820,813 N52K probably damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Qser1 A G 2: 104,789,013 S485P probably damaging Het
Rbm46 A T 3: 82,864,044 D421E probably benign Het
Rgs10 T C 7: 128,389,037 E109G probably damaging Het
Samd8 C T 14: 21,775,320 P178S probably benign Het
Scaf11 T C 15: 96,420,523 K387E probably damaging Het
Sccpdh G T 1: 179,670,606 V72F possibly damaging Het
Sec22a A T 16: 35,314,157 V285E probably damaging Het
Slc19a3 A G 1: 83,022,943 S118P probably damaging Het
Sun1 C A 5: 139,231,219 R338S probably benign Het
Taf1c A G 8: 119,598,678 F815S probably benign Het
Zcchc14 A T 8: 121,605,428 probably benign Het
Other mutations in Bpifb9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Bpifb9b APN 2 154316951 splice site probably null
IGL02119:Bpifb9b APN 2 154313624 missense possibly damaging 0.84
IGL02658:Bpifb9b APN 2 154311281 missense probably benign 0.00
R0230:Bpifb9b UTSW 2 154317075 missense probably damaging 1.00
R0269:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R0617:Bpifb9b UTSW 2 154319625 missense probably benign 0.00
R1953:Bpifb9b UTSW 2 154311314 missense probably damaging 0.99
R2050:Bpifb9b UTSW 2 154309604 missense possibly damaging 0.93
R2160:Bpifb9b UTSW 2 154319675 missense possibly damaging 0.53
R2354:Bpifb9b UTSW 2 154311742 missense probably benign
R4755:Bpifb9b UTSW 2 154319694 missense probably benign 0.01
R4872:Bpifb9b UTSW 2 154313631 missense probably damaging 0.99
R4914:Bpifb9b UTSW 2 154314106 splice site probably null
R4915:Bpifb9b UTSW 2 154314106 splice site probably null
R4917:Bpifb9b UTSW 2 154314106 splice site probably null
R4918:Bpifb9b UTSW 2 154314106 splice site probably null
R4950:Bpifb9b UTSW 2 154311659 missense probably damaging 1.00
R5438:Bpifb9b UTSW 2 154309368 missense possibly damaging 0.65
R5507:Bpifb9b UTSW 2 154317027 missense possibly damaging 0.91
R6255:Bpifb9b UTSW 2 154309364 missense probably damaging 0.98
R7130:Bpifb9b UTSW 2 154311672 missense probably damaging 0.98
R7161:Bpifb9b UTSW 2 154313615 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTTCAGGTTCTCCACAAATTGAGAAC -3'
(R):5'- TGTCAGGCAGTATGGTCCAG -3'

Sequencing Primer
(F):5'- TTGAGAACACAGCCATCATCCTG -3'
(R):5'- TTTTGGCTCCAGAGGGCC -3'
Posted On2014-10-02