Incidental Mutation 'R2200:Podn'
ID238598
Institutional Source Beutler Lab
Gene Symbol Podn
Ensembl Gene ENSMUSG00000028600
Gene Namepodocan
SynonymsSLRR5A
MMRRC Submission 040202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2200 (G1)
Quality Score212
Status Not validated
Chromosome4
Chromosomal Location108014791-108096445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108022590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 66 (D66G)
Ref Sequence ENSEMBL: ENSMUSP00000121478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044248] [ENSMUST00000106708] [ENSMUST00000106709] [ENSMUST00000146851]
Predicted Effect probably damaging
Transcript: ENSMUST00000044248
AA Change: D211G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600
AA Change: D211G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106708
AA Change: D211G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102319
Gene: ENSMUSG00000028600
AA Change: D211G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106709
AA Change: D211G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102320
Gene: ENSMUSG00000028600
AA Change: D211G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124265
Predicted Effect probably benign
Transcript: ENSMUST00000130026
SMART Domains Protein: ENSMUSP00000123184
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
LRR 27 49 1.53e2 SMART
LRR_TYP 50 73 7.37e-4 SMART
LRR 95 120 1.66e1 SMART
LRR 121 139 3.09e2 SMART
low complexity region 188 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145491
Predicted Effect probably damaging
Transcript: ENSMUST00000146851
AA Change: D66G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121478
Gene: ENSMUSG00000028600
AA Change: D66G

DomainStartEndE-ValueType
LRR 1 24 1.19e1 SMART
LRR 47 71 2.84e1 SMART
LRR 94 116 6.22e0 SMART
LRR 117 142 3.47e0 SMART
LRR_TYP 143 166 7.9e-4 SMART
LRR 188 213 1.26e1 SMART
LRR 214 237 2.82e0 SMART
LRR 262 284 1.53e2 SMART
LRR_TYP 285 308 7.37e-4 SMART
low complexity region 319 334 N/A INTRINSIC
low complexity region 359 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147597
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the small leucine-rich repeat protein family and contains an amino terminal CX3CXCX7C cysteine-rich cluster followed by a leucine-rich repeat domain. Studies suggest that this protein could function to inhibit smooth muscle cell proliferation and migration following arterial injury. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,958,423 I135M probably benign Het
Ano7 A G 1: 93,380,436 E63G possibly damaging Het
Asah1 A G 8: 41,343,728 probably null Het
B3gat2 C T 1: 23,762,792 P53L probably benign Het
Bmp8b A T 4: 123,123,022 M339L possibly damaging Het
Bpifb9b C A 2: 154,313,654 Q358K probably benign Het
Cbs T C 17: 31,624,264 D231G probably damaging Het
Chd6 A G 2: 160,983,753 Y1144H probably damaging Het
Clca3a2 T A 3: 144,813,924 I230L probably benign Het
Clec2d A T 6: 129,184,868 T155S possibly damaging Het
Cpxm1 G T 2: 130,393,197 F567L probably damaging Het
Cyp4f16 G T 17: 32,537,104 A36S probably damaging Het
Dnah17 T C 11: 118,102,409 probably benign Het
Eml5 T C 12: 98,825,417 D1280G probably damaging Het
Ergic1 C A 17: 26,641,592 A218D possibly damaging Het
Eva1a A G 6: 82,091,913 R74G probably benign Het
Fam160a1 A G 3: 85,730,321 S224P probably damaging Het
Fus T A 7: 127,977,228 N273K probably damaging Het
Ipo13 A C 4: 117,904,903 probably null Het
Itgb3 T A 11: 104,640,986 probably null Het
Lrif1 T A 3: 106,734,558 S63R probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Lrp1b A T 2: 41,284,165 N1547K probably benign Het
Mme A T 3: 63,380,292 N738I possibly damaging Het
Morc2a A G 11: 3,683,919 N677S probably benign Het
Mrpl35 A C 6: 71,817,739 L82V probably benign Het
Mybpc1 A T 10: 88,555,695 N313K probably damaging Het
Ptpru A T 4: 131,820,813 N52K probably damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Qser1 A G 2: 104,789,013 S485P probably damaging Het
Rbm46 A T 3: 82,864,044 D421E probably benign Het
Rgs10 T C 7: 128,389,037 E109G probably damaging Het
Samd8 C T 14: 21,775,320 P178S probably benign Het
Scaf11 T C 15: 96,420,523 K387E probably damaging Het
Sccpdh G T 1: 179,670,606 V72F possibly damaging Het
Sec22a A T 16: 35,314,157 V285E probably damaging Het
Slc19a3 A G 1: 83,022,943 S118P probably damaging Het
Sun1 C A 5: 139,231,219 R338S probably benign Het
Taf1c A G 8: 119,598,678 F815S probably benign Het
Zcchc14 A T 8: 121,605,428 probably benign Het
Other mutations in Podn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Podn APN 4 108022174 missense probably damaging 1.00
IGL01569:Podn APN 4 108024299 missense probably damaging 1.00
IGL02950:Podn APN 4 108017851 missense possibly damaging 0.65
R0119:Podn UTSW 4 108021594 missense probably damaging 1.00
R0196:Podn UTSW 4 108021498 missense probably damaging 1.00
R0499:Podn UTSW 4 108021594 missense probably damaging 1.00
R1539:Podn UTSW 4 108021567 missense probably damaging 1.00
R1705:Podn UTSW 4 108017858 missense probably benign 0.24
R2018:Podn UTSW 4 108023373 missense probably damaging 1.00
R2120:Podn UTSW 4 108023361 missense probably damaging 1.00
R2156:Podn UTSW 4 108021695 missense probably damaging 1.00
R2170:Podn UTSW 4 108022533 missense probably damaging 1.00
R2384:Podn UTSW 4 108022072 missense probably damaging 1.00
R4285:Podn UTSW 4 108021696 missense possibly damaging 0.69
R4606:Podn UTSW 4 108017867 missense probably benign 0.07
R5051:Podn UTSW 4 108014846 missense probably benign 0.15
R5945:Podn UTSW 4 108021713 missense possibly damaging 0.88
R6317:Podn UTSW 4 108027160 missense probably damaging 0.99
R6366:Podn UTSW 4 108018804 missense possibly damaging 0.95
R6830:Podn UTSW 4 108021417 missense possibly damaging 0.96
R6983:Podn UTSW 4 108024273 splice site probably null
X0004:Podn UTSW 4 108021567 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCTCCGATTCACACAGCATC -3'
(R):5'- CAGTGTCCCTGGGTTAAGAGAG -3'

Sequencing Primer
(F):5'- GATTCACACAGCATCCCCACG -3'
(R):5'- GTAGAAAAGTAGCCTGGTCCCTAC -3'
Posted On2014-10-02