Incidental Mutation 'R2200:Sun1'
ID238603
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene NameSad1 and UNC84 domain containing 1
SynonymsUnc84a, 5730434D03Rik, 4632417G13Rik
MMRRC Submission 040202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2200 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139200637-139249840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 139231219 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 338 (R338S)
Ref Sequence ENSEMBL: ENSMUSP00000056655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000100517] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000135720] [ENSMUST00000143562] [ENSMUST00000146715]
Predicted Effect probably benign
Transcript: ENSMUST00000058716
AA Change: R338S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: R338S

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078690
AA Change: R274S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: R274S

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100517
SMART Domains Protein: ENSMUSP00000098086
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110882
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110883
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110884
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126108
Predicted Effect probably benign
Transcript: ENSMUST00000128817
SMART Domains Protein: ENSMUSP00000119587
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
coiled coil region 58 126 N/A INTRINSIC
PDB:4DXS|A 207 258 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135720
SMART Domains Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
ZnF_C2H2 98 120 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142473
Predicted Effect probably benign
Transcript: ENSMUST00000143562
SMART Domains Protein: ENSMUSP00000116364
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 158 7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146715
SMART Domains Protein: ENSMUSP00000117679
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 160 4.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153469
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,958,423 I135M probably benign Het
Ano7 A G 1: 93,380,436 E63G possibly damaging Het
Asah1 A G 8: 41,343,728 probably null Het
B3gat2 C T 1: 23,762,792 P53L probably benign Het
Bmp8b A T 4: 123,123,022 M339L possibly damaging Het
Bpifb9b C A 2: 154,313,654 Q358K probably benign Het
Cbs T C 17: 31,624,264 D231G probably damaging Het
Chd6 A G 2: 160,983,753 Y1144H probably damaging Het
Clca3a2 T A 3: 144,813,924 I230L probably benign Het
Clec2d A T 6: 129,184,868 T155S possibly damaging Het
Cpxm1 G T 2: 130,393,197 F567L probably damaging Het
Cyp4f16 G T 17: 32,537,104 A36S probably damaging Het
Dnah17 T C 11: 118,102,409 probably benign Het
Eml5 T C 12: 98,825,417 D1280G probably damaging Het
Ergic1 C A 17: 26,641,592 A218D possibly damaging Het
Eva1a A G 6: 82,091,913 R74G probably benign Het
Fam160a1 A G 3: 85,730,321 S224P probably damaging Het
Fus T A 7: 127,977,228 N273K probably damaging Het
Ipo13 A C 4: 117,904,903 probably null Het
Itgb3 T A 11: 104,640,986 probably null Het
Lrif1 T A 3: 106,734,558 S63R probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Lrp1b A T 2: 41,284,165 N1547K probably benign Het
Mme A T 3: 63,380,292 N738I possibly damaging Het
Morc2a A G 11: 3,683,919 N677S probably benign Het
Mrpl35 A C 6: 71,817,739 L82V probably benign Het
Mybpc1 A T 10: 88,555,695 N313K probably damaging Het
Podn T C 4: 108,022,590 D66G probably damaging Het
Ptpru A T 4: 131,820,813 N52K probably damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Qser1 A G 2: 104,789,013 S485P probably damaging Het
Rbm46 A T 3: 82,864,044 D421E probably benign Het
Rgs10 T C 7: 128,389,037 E109G probably damaging Het
Samd8 C T 14: 21,775,320 P178S probably benign Het
Scaf11 T C 15: 96,420,523 K387E probably damaging Het
Sccpdh G T 1: 179,670,606 V72F possibly damaging Het
Sec22a A T 16: 35,314,157 V285E probably damaging Het
Slc19a3 A G 1: 83,022,943 S118P probably damaging Het
Taf1c A G 8: 119,598,678 F815S probably benign Het
Zcchc14 A T 8: 121,605,428 probably benign Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139234685 critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139234741 missense probably damaging 1.00
IGL02142:Sun1 APN 5 139231163 missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139241431 missense probably damaging 1.00
IGL02939:Sun1 APN 5 139235488 splice site probably benign
IGL03253:Sun1 APN 5 139223586 splice site probably benign
IGL03370:Sun1 APN 5 139231131 missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139226588 missense probably damaging 0.97
R0124:Sun1 UTSW 5 139246679 unclassified probably benign
R0145:Sun1 UTSW 5 139241411 missense probably damaging 0.98
R0376:Sun1 UTSW 5 139226699 unclassified probably benign
R0512:Sun1 UTSW 5 139234847 splice site probably benign
R0729:Sun1 UTSW 5 139237864 unclassified probably benign
R0733:Sun1 UTSW 5 139231163 missense possibly damaging 0.63
R1188:Sun1 UTSW 5 139238856 missense probably damaging 0.98
R1724:Sun1 UTSW 5 139235725 missense probably benign
R1733:Sun1 UTSW 5 139230789 missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139235732 critical splice donor site probably null
R2033:Sun1 UTSW 5 139225438 missense probably damaging 1.00
R3084:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3085:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3771:Sun1 UTSW 5 139238820 unclassified probably benign
R3772:Sun1 UTSW 5 139238820 unclassified probably benign
R3804:Sun1 UTSW 5 139225362 nonsense probably null
R4300:Sun1 UTSW 5 139227594 unclassified probably benign
R4428:Sun1 UTSW 5 139234475 intron probably benign
R4993:Sun1 UTSW 5 139225333 missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139226891 splice site probably null
R5363:Sun1 UTSW 5 139234743 missense probably damaging 1.00
R5826:Sun1 UTSW 5 139245416 missense probably damaging 1.00
R6753:Sun1 UTSW 5 139215259 splice site probably null
R7218:Sun1 UTSW 5 139226687 missense unknown
R7320:Sun1 UTSW 5 139248484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAACCTTCTGTGCAGTATTC -3'
(R):5'- AACCACAGCTGCTGAGTTTTGG -3'

Sequencing Primer
(F):5'- AACCTTCTGTGCAGTATTCTGATTG -3'
(R):5'- CTTGAACTCAGGACCTCTGGAAG -3'
Posted On2014-10-02