Incidental Mutation 'R2200:Morc2a'
ID238615
Institutional Source Beutler Lab
Gene Symbol Morc2a
Ensembl Gene ENSMUSG00000034543
Gene Namemicrorchidia 2A
SynonymsZcwcc1, 8430403M08Rik
MMRRC Submission 040202-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2200 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3649494-3690477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3683919 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 677 (N677S)
Ref Sequence ENSEMBL: ENSMUSP00000094176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093389] [ENSMUST00000096441]
Predicted Effect probably benign
Transcript: ENSMUST00000093389
AA Change: N677S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091087
Gene: ENSMUSG00000034543
AA Change: N677S

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 495 542 5.1e-18 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096441
AA Change: N677S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000094176
Gene: ENSMUSG00000034543
AA Change: N677S

DomainStartEndE-ValueType
HATPase_c 24 134 5.35e0 SMART
coiled coil region 285 322 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Pfam:zf-CW 494 543 1.7e-19 PFAM
coiled coil region 555 583 N/A INTRINSIC
low complexity region 600 618 N/A INTRINSIC
low complexity region 678 704 N/A INTRINSIC
low complexity region 714 729 N/A INTRINSIC
coiled coil region 742 776 N/A INTRINSIC
coiled coil region 966 1011 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131517
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Microrchidia (MORC) protein superfamily. The encoded protein is known to regulate the condensation of heterochromatin in response to DNA damage and play a role in repressing transcription. The protein has been found to regulate the activity of ATP citrate lyase via specific interaction with this enzyme in the cytosol of lipogenic breast cancer cells. The protein also plays a role in lipogenesis and adipocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,958,423 I135M probably benign Het
Ano7 A G 1: 93,380,436 E63G possibly damaging Het
Asah1 A G 8: 41,343,728 probably null Het
B3gat2 C T 1: 23,762,792 P53L probably benign Het
Bmp8b A T 4: 123,123,022 M339L possibly damaging Het
Bpifb9b C A 2: 154,313,654 Q358K probably benign Het
Cbs T C 17: 31,624,264 D231G probably damaging Het
Chd6 A G 2: 160,983,753 Y1144H probably damaging Het
Clca3a2 T A 3: 144,813,924 I230L probably benign Het
Clec2d A T 6: 129,184,868 T155S possibly damaging Het
Cpxm1 G T 2: 130,393,197 F567L probably damaging Het
Cyp4f16 G T 17: 32,537,104 A36S probably damaging Het
Dnah17 T C 11: 118,102,409 probably benign Het
Eml5 T C 12: 98,825,417 D1280G probably damaging Het
Ergic1 C A 17: 26,641,592 A218D possibly damaging Het
Eva1a A G 6: 82,091,913 R74G probably benign Het
Fam160a1 A G 3: 85,730,321 S224P probably damaging Het
Fus T A 7: 127,977,228 N273K probably damaging Het
Ipo13 A C 4: 117,904,903 probably null Het
Itgb3 T A 11: 104,640,986 probably null Het
Lrif1 T A 3: 106,734,558 S63R probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Lrp1b A T 2: 41,284,165 N1547K probably benign Het
Mme A T 3: 63,380,292 N738I possibly damaging Het
Mrpl35 A C 6: 71,817,739 L82V probably benign Het
Mybpc1 A T 10: 88,555,695 N313K probably damaging Het
Podn T C 4: 108,022,590 D66G probably damaging Het
Ptpru A T 4: 131,820,813 N52K probably damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Qser1 A G 2: 104,789,013 S485P probably damaging Het
Rbm46 A T 3: 82,864,044 D421E probably benign Het
Rgs10 T C 7: 128,389,037 E109G probably damaging Het
Samd8 C T 14: 21,775,320 P178S probably benign Het
Scaf11 T C 15: 96,420,523 K387E probably damaging Het
Sccpdh G T 1: 179,670,606 V72F possibly damaging Het
Sec22a A T 16: 35,314,157 V285E probably damaging Het
Slc19a3 A G 1: 83,022,943 S118P probably damaging Het
Sun1 C A 5: 139,231,219 R338S probably benign Het
Taf1c A G 8: 119,598,678 F815S probably benign Het
Zcchc14 A T 8: 121,605,428 probably benign Het
Other mutations in Morc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Morc2a APN 11 3680283 missense probably damaging 0.99
IGL00914:Morc2a APN 11 3668844 splice site probably null
IGL01081:Morc2a APN 11 3688149 missense probably damaging 1.00
IGL01092:Morc2a APN 11 3684042 missense probably benign 0.00
IGL01292:Morc2a APN 11 3688175 missense probably damaging 1.00
IGL01326:Morc2a APN 11 3681775 missense probably benign 0.03
IGL01526:Morc2a APN 11 3650428 missense probably benign 0.00
IGL01651:Morc2a APN 11 3658727 critical splice donor site probably null
IGL02860:Morc2a APN 11 3661821 splice site probably benign
IGL03372:Morc2a APN 11 3681813 splice site probably benign
R0136:Morc2a UTSW 11 3685907 intron probably null
R0267:Morc2a UTSW 11 3678567 missense probably benign 0.03
R0279:Morc2a UTSW 11 3683989 missense probably benign 0.09
R0556:Morc2a UTSW 11 3681809 critical splice donor site probably null
R1084:Morc2a UTSW 11 3650454 splice site probably benign
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1148:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1341:Morc2a UTSW 11 3680216 missense possibly damaging 0.80
R1460:Morc2a UTSW 11 3683794 missense probably benign 0.01
R1493:Morc2a UTSW 11 3678557 missense probably benign 0.00
R1665:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1668:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1669:Morc2a UTSW 11 3675885 missense probably benign 0.00
R1812:Morc2a UTSW 11 3685831 missense probably damaging 0.98
R2132:Morc2a UTSW 11 3679787 missense possibly damaging 0.89
R2133:Morc2a UTSW 11 3680302 nonsense probably null
R2698:Morc2a UTSW 11 3685400 missense probably damaging 1.00
R3236:Morc2a UTSW 11 3683612 missense probably benign
R3698:Morc2a UTSW 11 3679672 nonsense probably null
R3743:Morc2a UTSW 11 3683700 missense possibly damaging 0.46
R4119:Morc2a UTSW 11 3683868 missense probably benign 0.00
R4898:Morc2a UTSW 11 3676664 nonsense probably null
R5148:Morc2a UTSW 11 3689084 missense probably damaging 1.00
R5228:Morc2a UTSW 11 3685439 missense probably damaging 0.96
R5395:Morc2a UTSW 11 3688232 missense possibly damaging 0.94
R5808:Morc2a UTSW 11 3683781 missense probably benign 0.00
R5942:Morc2a UTSW 11 3679936 missense probably damaging 1.00
R6634:Morc2a UTSW 11 3672376 critical splice donor site probably null
R7056:Morc2a UTSW 11 3675925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAGGAACCTGTACGGAGACC -3'
(R):5'- AGGGAAAGCATCTCACCACG -3'

Sequencing Primer
(F):5'- CCTTTACCTGCGGTGATCAAGAATG -3'
(R):5'- TCACCACGGACTGTTTGAC -3'
Posted On2014-10-02