Incidental Mutation 'R2201:Eng'
ID238634
Institutional Source Beutler Lab
Gene Symbol Eng
Ensembl Gene ENSMUSG00000026814
Gene Nameendoglin
SynonymsCD105, Endo
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2201 (G1)
Quality Score212
Status Validated
Chromosome2
Chromosomal Location32646595-32682669 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 32673740 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009705] [ENSMUST00000113272] [ENSMUST00000167841]
Predicted Effect probably benign
Transcript: ENSMUST00000009705
SMART Domains Protein: ENSMUSP00000009705
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113272
SMART Domains Protein: ENSMUSP00000108897
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
ZP 361 568 1.29e-2 SMART
transmembrane domain 586 608 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156306
SMART Domains Protein: ENSMUSP00000122186
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
ZP 52 283 1.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167841
SMART Domains Protein: ENSMUSP00000130585
Gene: ENSMUSG00000026814

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 336 346 N/A INTRINSIC
ZP 362 569 1.29e-2 SMART
transmembrane domain 587 609 N/A INTRINSIC
low complexity region 616 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196848
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted null mutations show defective vascular development, extra-arterial hematopoiesis, cardiac defects and die by embryonic day 11.0. Heterozygotes develop hemorrhagic telangiectasia causing strokes, fatal hemorrhage and heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Eng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Eng APN 2 32672382 missense probably benign 0.03
IGL01432:Eng APN 2 32669532 missense possibly damaging 0.66
IGL02203:Eng APN 2 32671486 missense probably benign 0.35
IGL02330:Eng APN 2 32669569 splice site probably null
IGL02633:Eng APN 2 32673274 missense probably damaging 0.99
IGL02747:Eng APN 2 32672958 critical splice donor site probably null
R0008:Eng UTSW 2 32677680 missense probably damaging 0.97
R0149:Eng UTSW 2 32672385 critical splice donor site probably null
R0206:Eng UTSW 2 32678993 missense probably benign 0.15
R0208:Eng UTSW 2 32678993 missense probably benign 0.15
R0360:Eng UTSW 2 32679137 missense probably benign 0.27
R0364:Eng UTSW 2 32679137 missense probably benign 0.27
R1399:Eng UTSW 2 32673322 missense probably damaging 0.98
R1520:Eng UTSW 2 32672941 missense probably benign 0.41
R1752:Eng UTSW 2 32673392 missense probably benign
R2162:Eng UTSW 2 32679047 missense probably damaging 1.00
R2389:Eng UTSW 2 32657672 critical splice donor site probably null
R3021:Eng UTSW 2 32678568 missense probably damaging 1.00
R3428:Eng UTSW 2 32657533 missense probably damaging 0.97
R4704:Eng UTSW 2 32678912 missense probably benign 0.00
R5024:Eng UTSW 2 32673392 missense probably benign 0.00
R5130:Eng UTSW 2 32681506 missense probably damaging 1.00
R5182:Eng UTSW 2 32672959 critical splice donor site probably null
R6270:Eng UTSW 2 32673643 missense probably benign 0.26
R6790:Eng UTSW 2 32669445 missense probably damaging 0.99
R6872:Eng UTSW 2 32673275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCTCTGAGCCTCACTGG -3'
(R):5'- AATTTCTGTGACCACCTGGC -3'

Sequencing Primer
(F):5'- ACCCAGTGACGGTCTACTC -3'
(R):5'- CTCCCAGGTTCTGAGAATACCAGTG -3'
Posted On2014-10-02