Incidental Mutation 'R2201:Slc5a5'
ID238665
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Namesolute carrier family 5 (sodium iodide symporter), member 5
SynonymsNIS
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70882889-70892757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70892458 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 68 (M68I)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809] [ENSMUST00000054220] [ENSMUST00000212129] [ENSMUST00000212378] [ENSMUST00000212494] [ENSMUST00000212709] [ENSMUST00000212796] [ENSMUST00000213053]
Predicted Effect probably damaging
Transcript: ENSMUST00000000809
AA Change: M68I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: M68I

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054220
SMART Domains Protein: ENSMUSP00000058368
Gene: ENSMUSG00000045128

DomainStartEndE-ValueType
Pfam:Ribosomal_L18ae 7 130 1.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212019
Predicted Effect probably benign
Transcript: ENSMUST00000212129
Predicted Effect probably benign
Transcript: ENSMUST00000212378
Predicted Effect probably benign
Transcript: ENSMUST00000212494
Predicted Effect probably benign
Transcript: ENSMUST00000212709
Predicted Effect probably benign
Transcript: ENSMUST00000212796
Predicted Effect probably benign
Transcript: ENSMUST00000213053
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 70888537 missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 70890376 unclassified probably benign
IGL01394:Slc5a5 APN 8 70889388 nonsense probably null
IGL01571:Slc5a5 APN 8 70891332 unclassified probably benign
IGL02043:Slc5a5 APN 8 70892429 missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 70886120 missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 70888911 missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 70890271 missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 70892517 missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 70890328 missense probably benign 0.45
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 70891675 missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 70883875 missense probably benign 0.01
R0781:Slc5a5 UTSW 8 70890220 missense probably benign 0.19
R1061:Slc5a5 UTSW 8 70890221 missense probably benign 0.00
R1400:Slc5a5 UTSW 8 70889435 missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 70892334 missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 70888587 missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 70889751 intron probably null
R2111:Slc5a5 UTSW 8 70889751 intron probably null
R2112:Slc5a5 UTSW 8 70889751 intron probably null
R3978:Slc5a5 UTSW 8 70889395 missense probably benign 0.00
R4244:Slc5a5 UTSW 8 70890286 missense probably benign
R5161:Slc5a5 UTSW 8 70888848 missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 70891179 missense probably damaging 1.00
R5718:Slc5a5 UTSW 8 70887755 missense probably benign 0.00
R5740:Slc5a5 UTSW 8 70888917 splice site probably null
R5869:Slc5a5 UTSW 8 70892330 missense probably damaging 1.00
R6268:Slc5a5 UTSW 8 70888620 missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTTCCCATGGGACCAAG -3'
(R):5'- GAGTTACCTGTCTCCATGGAGG -3'

Sequencing Primer
(F):5'- CCAAGTCCCCTACCTGGTAG -3'
(R):5'- TCTCCATGGAGGGCGCG -3'
Posted On2014-10-02