Incidental Mutation 'R2201:Adcy7'
ID238666
Institutional Source Beutler Lab
Gene Symbol Adcy7
Ensembl Gene ENSMUSG00000031659
Gene Nameadenylate cyclase 7
Synonyms
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88272403-88329962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88317978 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 500 (A500T)
Ref Sequence ENSEMBL: ENSMUSP00000132528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098521] [ENSMUST00000168545] [ENSMUST00000169037] [ENSMUST00000171456]
Predicted Effect probably damaging
Transcript: ENSMUST00000098521
AA Change: A500T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096122
Gene: ENSMUSG00000031659
AA Change: A500T

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168545
AA Change: A500T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129252
Gene: ENSMUSG00000031659
AA Change: A500T

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169037
AA Change: A500T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130594
Gene: ENSMUSG00000031659
AA Change: A500T

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171456
AA Change: A500T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132528
Gene: ENSMUSG00000031659
AA Change: A500T

DomainStartEndE-ValueType
low complexity region 91 104 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 1.2e-35 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect unknown
Transcript: ENSMUST00000210688
AA Change: A200T
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound adenylate cyclase that catalyses the formation of cyclic AMP from ATP and is inhibitable by calcium. The product of this gene is a member of the adenylyl cyclase class-4/guanylyl cyclase enzyme family that is characterized by the presence of twelve membrane-spanning domains in its sequences. Several transcript variants have been observed for this gene, but the full-length natures of only two have been determined so far. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display some degree of pre- or postnatal lethality. Surviving adults for one allele appear to be normal. Heterozygous females for one allele display decreased depression related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Adcy7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Adcy7 APN 8 88318790 splice site probably benign
IGL01434:Adcy7 APN 8 88324844 missense probably damaging 1.00
IGL01784:Adcy7 APN 8 88314123 missense probably damaging 1.00
IGL02506:Adcy7 APN 8 88317943 missense probably damaging 1.00
IGL03184:Adcy7 APN 8 88308643 missense probably benign 0.00
IGL03406:Adcy7 APN 8 88318319 nonsense probably null
PIT4283001:Adcy7 UTSW 8 88315492 missense probably damaging 1.00
PIT4453001:Adcy7 UTSW 8 88323636 missense probably benign 0.07
R0265:Adcy7 UTSW 8 88324763 missense probably damaging 0.96
R0963:Adcy7 UTSW 8 88312265 missense probably damaging 1.00
R0990:Adcy7 UTSW 8 88325452 missense possibly damaging 0.57
R1055:Adcy7 UTSW 8 88318057 splice site probably benign
R1494:Adcy7 UTSW 8 88320207 missense probably benign 0.00
R1764:Adcy7 UTSW 8 88308840 missense probably benign 0.00
R2062:Adcy7 UTSW 8 88312274 missense probably damaging 1.00
R2090:Adcy7 UTSW 8 88315857 missense probably damaging 0.98
R2413:Adcy7 UTSW 8 88309818 missense probably benign 0.20
R2849:Adcy7 UTSW 8 88327393 missense probably benign 0.38
R4020:Adcy7 UTSW 8 88308734 missense probably benign 0.00
R4086:Adcy7 UTSW 8 88315786 missense probably benign 0.01
R4679:Adcy7 UTSW 8 88317937 missense probably benign 0.01
R5069:Adcy7 UTSW 8 88327697 missense probably damaging 1.00
R5253:Adcy7 UTSW 8 88314114 missense probably damaging 1.00
R5286:Adcy7 UTSW 8 88324859 missense probably damaging 1.00
R5427:Adcy7 UTSW 8 88326201 critical splice donor site probably null
R5457:Adcy7 UTSW 8 88311021 missense probably damaging 1.00
R5689:Adcy7 UTSW 8 88324784 missense probably benign 0.00
R5907:Adcy7 UTSW 8 88312228 missense possibly damaging 0.76
R5909:Adcy7 UTSW 8 88325496 missense probably damaging 1.00
R5997:Adcy7 UTSW 8 88326392 missense probably benign 0.41
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6133:Adcy7 UTSW 8 88325439 missense possibly damaging 0.84
R6190:Adcy7 UTSW 8 88325730 intron probably null
R6213:Adcy7 UTSW 8 88314137 missense probably damaging 1.00
R6287:Adcy7 UTSW 8 88311108 missense possibly damaging 0.80
R6502:Adcy7 UTSW 8 88325479 missense probably damaging 1.00
R6989:Adcy7 UTSW 8 88308786 missense probably benign
R7042:Adcy7 UTSW 8 88315750 missense probably damaging 0.99
X0067:Adcy7 UTSW 8 88324600 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCATGCTCGAAGAATACTATAGG -3'
(R):5'- CACAATGCAGCTAAAGGGGC -3'

Sequencing Primer
(F):5'- TTTCCCAGACCAGCCAGTG -3'
(R):5'- CAGCTAAAGGGGCAAGGCTG -3'
Posted On2014-10-02