Incidental Mutation 'R2201:Tln2'
ID238669
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67375757 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 310 (T310A)
Ref Sequence ENSEMBL: ENSMUSP00000039633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784]
Predicted Effect probably damaging
Transcript: ENSMUST00000039662
AA Change: T310A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: T310A

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040025
AA Change: T310A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: T310A

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215784
AA Change: T312A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCTGAATTCACTTGCTG -3'
(R):5'- ACAAACCTGTGTCATGGGAC -3'

Sequencing Primer
(F):5'- CTGAATTCACTTGCTGCAGTTAG -3'
(R):5'- GCAGAAATGTCACTCACTATTGGTCC -3'
Posted On2014-10-02