Incidental Mutation 'R2202:Ahdc1'
ID238726
Institutional Source Beutler Lab
Gene Symbol Ahdc1
Ensembl Gene ENSMUSG00000037692
Gene NameAT hook, DNA binding motif, containing 1
Synonyms
MMRRC Submission 040204-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R2202 (G1)
Quality Score183
Status Not validated
Chromosome4
Chromosomal Location133011260-133078110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133065909 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1487 (E1487G)
Ref Sequence ENSEMBL: ENSMUSP00000101536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044521] [ENSMUST00000105914] [ENSMUST00000105915] [ENSMUST00000105916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044521
AA Change: E1487G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047113
Gene: ENSMUSG00000037692
AA Change: E1487G

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105914
AA Change: E1487G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101534
Gene: ENSMUSG00000037692
AA Change: E1487G

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
Pfam:DUF4683 559 639 6.4e-15 PFAM
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105915
AA Change: E1487G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101535
Gene: ENSMUSG00000037692
AA Change: E1487G

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105916
AA Change: E1487G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101536
Gene: ENSMUSG00000037692
AA Change: E1487G

DomainStartEndE-ValueType
low complexity region 25 48 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 207 234 N/A INTRINSIC
low complexity region 259 279 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 327 341 N/A INTRINSIC
low complexity region 369 379 N/A INTRINSIC
AT_hook 395 407 2.04e2 SMART
low complexity region 418 446 N/A INTRINSIC
low complexity region 491 508 N/A INTRINSIC
AT_hook 541 553 5.47e-1 SMART
low complexity region 661 685 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
low complexity region 770 785 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
low complexity region 836 857 N/A INTRINSIC
low complexity region 963 974 N/A INTRINSIC
low complexity region 1003 1028 N/A INTRINSIC
low complexity region 1072 1084 N/A INTRINSIC
low complexity region 1153 1168 N/A INTRINSIC
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1243 1251 N/A INTRINSIC
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1422 1436 N/A INTRINSIC
low complexity region 1513 1528 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156677
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two AT-hooks, which likely function in DNA binding. Mutations in this gene were found in individuals with Xia-Gibbs syndrome. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,668 V249A possibly damaging Het
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abca14 T C 7: 120,289,541 Y1237H probably benign Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
AI987944 T C 7: 41,374,526 E343G probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Atp1b1 G T 1: 164,453,515 T11K probably benign Het
Calr3 A G 8: 72,434,839 L40S probably damaging Het
Ccar1 A C 10: 62,745,287 D1119E unknown Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cdk12 T G 11: 98,210,638 S441A unknown Het
Ces4a T A 8: 105,146,114 V333E probably damaging Het
Cfap61 T C 2: 146,214,680 L1193P probably damaging Het
Chd2 A T 7: 73,478,668 D856E probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cln3 T A 7: 126,579,218 H211L probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dcstamp T A 15: 39,754,312 V39E probably damaging Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Duox1 A G 2: 122,344,713 T1331A probably benign Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Fcer2a T C 8: 3,688,557 E60G possibly damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Fnbp1l A T 3: 122,546,962 M463K probably benign Het
Garem2 A G 5: 30,114,764 D408G probably benign Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Il15ra T A 2: 11,718,344 probably null Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Knstrn T A 2: 118,830,975 probably null Het
Letm1 C A 5: 33,769,486 V156L possibly damaging Het
Lrrc24 G A 15: 76,722,911 P95L probably damaging Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Me3 T C 7: 89,850,381 Y535H probably damaging Het
Nfatc2ip T C 7: 126,391,295 E178G probably benign Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr164 C T 16: 19,286,297 A149T probably benign Het
Olfr714 T A 7: 107,074,316 W163R probably damaging Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pid1 T A 1: 84,038,438 I69F probably damaging Het
Pkhd1 A G 1: 20,537,360 S1091P probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Plxnd1 T C 6: 115,962,764 N1418S probably benign Het
Pmm1 T C 15: 81,956,400 T82A probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,650 T913M possibly damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Rbm8a2 T C 1: 175,978,854 E19G possibly damaging Het
Rgs3 T C 4: 62,690,504 S336P probably damaging Het
Serpina11 G T 12: 103,985,974 T179K probably damaging Het
Serpina1f T C 12: 103,693,396 N209S possibly damaging Het
Serpinf2 G A 11: 75,436,762 T159I probably benign Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc22a20 A T 19: 5,971,525 I483N possibly damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tex45 A T 8: 3,479,028 D201V probably benign Het
Tln1 C T 4: 43,553,083 probably null Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tmx3 T C 18: 90,527,913 F206S probably damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trappc10 A G 10: 78,199,042 probably null Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r53 T A 7: 12,601,439 Y98F probably damaging Het
Vmn2r58 T A 7: 41,864,170 N350Y probably benign Het
Vmn2r82 A T 10: 79,356,685 H32L probably benign Het
Wsb1 T C 11: 79,240,386 I395V probably benign Het
Zfat T C 15: 68,179,860 D695G probably benign Het
Zfp358 G T 8: 3,496,995 V526F possibly damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Other mutations in Ahdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Ahdc1 APN 4 133063062 missense probably benign 0.33
IGL02293:Ahdc1 APN 4 133065618 missense possibly damaging 0.85
IGL02338:Ahdc1 APN 4 133062549 missense possibly damaging 0.73
IGL02828:Ahdc1 APN 4 133062921 missense possibly damaging 0.96
IGL02859:Ahdc1 APN 4 133062692 missense possibly damaging 0.53
IGL02859:Ahdc1 APN 4 133062693 missense probably damaging 0.99
IGL02901:Ahdc1 APN 4 133064934 missense possibly damaging 0.85
IGL03323:Ahdc1 APN 4 133065428 missense probably benign
FR4304:Ahdc1 UTSW 4 133062759 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062757 small insertion probably benign
FR4548:Ahdc1 UTSW 4 133062760 small insertion probably benign
FR4737:Ahdc1 UTSW 4 133062759 small insertion probably benign
R0325:Ahdc1 UTSW 4 133062719 missense unknown
R0550:Ahdc1 UTSW 4 133063037 missense probably benign 0.33
R0681:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0683:Ahdc1 UTSW 4 133065516 missense possibly damaging 0.53
R0731:Ahdc1 UTSW 4 133062951 missense possibly damaging 0.86
R0751:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1137:Ahdc1 UTSW 4 133062113 missense possibly damaging 0.68
R1184:Ahdc1 UTSW 4 133065396 missense probably benign 0.02
R1331:Ahdc1 UTSW 4 133063691 missense probably benign 0.18
R1599:Ahdc1 UTSW 4 133064936 missense possibly damaging 0.91
R2205:Ahdc1 UTSW 4 133065909 missense possibly damaging 0.72
R2261:Ahdc1 UTSW 4 133063163 missense unknown
R2262:Ahdc1 UTSW 4 133063163 missense unknown
R3683:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3684:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3685:Ahdc1 UTSW 4 133065702 missense possibly damaging 0.96
R3713:Ahdc1 UTSW 4 133065986 missense possibly damaging 0.85
R4027:Ahdc1 UTSW 4 133064165 missense possibly damaging 0.73
R4807:Ahdc1 UTSW 4 133064313 missense possibly damaging 0.86
R4987:Ahdc1 UTSW 4 133064320 missense possibly damaging 0.53
R5126:Ahdc1 UTSW 4 133063522 missense probably benign 0.18
R5276:Ahdc1 UTSW 4 133062798 missense possibly damaging 0.93
R5680:Ahdc1 UTSW 4 133065596 missense probably benign
R5997:Ahdc1 UTSW 4 133063895 missense probably benign 0.05
R6050:Ahdc1 UTSW 4 133065891 missense possibly damaging 0.85
R6271:Ahdc1 UTSW 4 133064724 missense possibly damaging 0.73
R6410:Ahdc1 UTSW 4 133062899 missense probably damaging 0.97
R6519:Ahdc1 UTSW 4 133064768 missense possibly damaging 0.86
R6970:Ahdc1 UTSW 4 133062345 missense possibly damaging 0.96
T0722:Ahdc1 UTSW 4 133062754 small insertion probably benign
T0975:Ahdc1 UTSW 4 133062754 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTCAAGCATGGTCTTCAGGG -3'
(R):5'- TACCTGTAGGCAGTGTCCTG -3'

Sequencing Primer
(F):5'- TAGCCTGAGCCATGCTGC -3'
(R):5'- CAGTGTCCTGCAGGGGC -3'
Posted On2014-10-02