Incidental Mutation 'R2202:0610040J01Rik'
List |< first << previous [record 67 of 386652] next >> last >|
ID238729
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene NameRIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission
Accession Numbers
Stock #R2202 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location63812495-63899619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63898668 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted sequence gene model
Predicted Effect possibly damaging
Transcript: ENSMUST00000081747
AA Change: V249A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: V249A

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019B03Rik A T 8: 3,479,028 D201V probably benign Het
4932411G14Rik A G 13: 59,731,621 C34R possibly damaging Het
5330417C22Rik C T 3: 108,475,043 G316E probably damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abca14 T C 7: 120,289,541 Y1237H probably benign Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Abi3bp C T 16: 56,650,725 R658* probably null Het
Adamts7 A T 9: 90,180,676 K394N possibly damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
AI987944 T C 7: 41,374,526 E346G probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q200P probably benign Het
Atp1b1 G T 1: 164,453,515 T67K probably benign Het
B020018G12Rik T C 1: 175,978,854 E19G possibly damaging Het
BC016579 C T 16: 45,628,323 probably benign Het
C030006K11Rik G A 15: 76,722,911 P95L probably damaging Het
Calr3 A G 8: 72,434,839 L148S probably damaging Het
Ccar1 A C 10: 62,745,287 D1119E unknown Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cdk12 T G 11: 98,210,638 S441A unknown Het
Cenpe T C 3: 135,270,966 probably benign Het
Ces4a T A 8: 105,146,114 V333E probably damaging Het
Cfap61 T C 2: 146,214,680 L1193P probably damaging Het
Chd2 A T 7: 73,478,668 D856E probably benign Het
Chd9 G T 8: 90,983,560 probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cln3 T A 7: 126,579,218 H211L probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dcstamp T A 15: 39,754,312 V39E probably damaging Het
Dicer1 C T 12: 104,731,038 V87M possibly damaging Het
Duox1 A G 2: 122,344,713 T1331A probably benign Het
Fam184a T A 10: 53,652,434 Q777L probably damaging Het
Fcer2a T C 8: 3,688,557 E100G probably benign Het
Flnc C T 6: 29,459,508 P2569S probably damaging Het
Fnbp1l A T 3: 122,546,962 M463K probably benign Het
Gareml A G 5: 30,114,764 D408G probably benign Het
Glcci1 T C 6: 8,558,488 probably benign Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D237E probably benign Het
Gm7742 A G 17: 21,199,019 E23G probably benign Het
Gpc3 T A X: 52,397,206 I344F probably damaging Homo
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Il15ra T A 2: 11,718,344 Y60N probably damaging Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T678I probably benign Homo
Jmjd1c A G 10: 67,239,463 probably null Het
Knstrn T A 2: 118,830,975 probably null Het
Letm1 C A 5: 33,769,486 V156L possibly damaging Het
Map2k2 T C 10: 81,119,379 S235P possibly damaging Het
Me3 T C 7: 89,850,381 Y535H probably damaging Het
Nbas C T 12: 13,520,692 probably benign Het
Ndst3 T A 3: 123,556,833 probably benign Het
Nfatc2ip T C 7: 126,391,295 E178G probably benign Het
Nop56 T A 2: 130,277,568 I368N probably null Het
Npas3 C T 12: 54,048,882 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F probably null Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr164 C T 16: 19,286,297 A149T probably benign Het
Olfr714 T A 7: 107,074,316 W163R probably damaging Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Phgdh A G 3: 98,328,351 probably benign Het
Pid1 T A 1: 84,038,438 I83F probably damaging Het
Pkhd1 A G 1: 20,537,360 S1091P probably benign Het
Plcb4 T C 2: 136,002,594 I1083T probably benign Het
Plxnd1 T C 6: 115,962,764 N1418S probably benign Het
Pmm1 T C 15: 81,956,400 T82A probably benign Het
Prmt10 T A 8: 77,558,864 probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,650 T913M possibly damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Rgs3 T C 4: 62,690,504 S734P probably damaging Het
Rrn3 T A 16: 13,806,547 probably benign Het
Serpina11 G T 12: 103,985,974 T181K probably damaging Het
Serpina1f T C 12: 103,693,396 N209S possibly damaging Het
Serpinf2 G A 11: 75,436,762 T159I probably benign Het
Sh2b3 A G 5: 121,818,691 probably benign Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc22a20 A T 19: 5,971,525 I483N possibly damaging Het
Stat1 G A 1: 52,151,226 probably benign Het
Stoml2 G T 4: 43,030,243 Y113* probably null Het
Susd1 A G 4: 59,349,843 L584P possibly damaging Het
Tln1 C T 4: 43,553,083 C336Y probably damaging Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tmx3 T C 18: 90,527,913 F206S probably damaging Het
Tnfsf14 T C 17: 57,190,638 D198G probably damaging Het
Trappc10 A G 10: 78,199,042 probably null Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttll8 T A 15: 88,914,648 probably benign Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Txndc16 T C 14: 45,162,233 probably benign Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r53 T A 7: 12,601,439 Y98F probably damaging Het
Vmn2r58 T A 7: 41,864,170 N350Y probably benign Het
Vmn2r82 A T 10: 79,356,685 H32L probably benign Het
Vps52 T C 17: 33,965,272 probably benign Het
Wsb1 T C 11: 79,240,386 I395V probably benign Het
Zfat T C 15: 68,179,860 D695G probably benign Het
Zfp358 G T 8: 3,496,995 V526F possibly damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zmat1 A G X: 134,973,112 L510P possibly damaging Homo
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.60
IGL02229:0610040J01Rik APN 5 63898353 missense possibly damaging 0.51
IGL02389:0610040J01Rik APN 5 63896483 missense probably benign 0.20
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.00
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.09
R0411:0610040J01Rik UTSW 5 63896491 splice donor site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.79
R3160:0610040J01Rik UTSW 5 63896490 splice donor site probably benign
R3161:0610040J01Rik UTSW 5 63896490 splice donor site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 missense unknown
R4429:0610040J01Rik UTSW 5 63898839 missense unknown
R4430:0610040J01Rik UTSW 5 63898839 missense unknown
R4431:0610040J01Rik UTSW 5 63898839 missense unknown
R4464:0610040J01Rik UTSW 5 63898839 missense unknown
R4465:0610040J01Rik UTSW 5 63898839 missense unknown
R4467:0610040J01Rik UTSW 5 63898839 missense unknown
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGCAGTGGCAGATCACATC -3'
(R):5'- TGCATCTTCTCCTGCGGTAG -3'

Sequencing Primer
(F):5'- GTGGCAGATCACATCCCATAC -3'
(R):5'- GCAGCTTCTAATGCTGCGAG -3'
Posted OnOct 02, 2014