Incidental Mutation 'R2202:Olfr714'
ID238746
Institutional Source Beutler Lab
Gene Symbol Olfr714
Ensembl Gene ENSMUSG00000049674
Gene Nameolfactory receptor 714
SynonymsGA_x6K02T2PBJ9-9453401-9454354, P4, MOR263-2
MMRRC Submission 040204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2202 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107070981-107077802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107074316 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 163 (W163R)
Ref Sequence ENSEMBL: ENSMUSP00000151106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054629] [ENSMUST00000214429]
Predicted Effect probably damaging
Transcript: ENSMUST00000054629
AA Change: W163R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095742
Gene: ENSMUSG00000049674
AA Change: W163R

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.5e-56 PFAM
Pfam:7tm_1 42 291 3.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214123
Predicted Effect probably damaging
Transcript: ENSMUST00000214429
AA Change: W163R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,668 V249A possibly damaging Het
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abca14 T C 7: 120,289,541 Y1237H probably benign Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
AI987944 T C 7: 41,374,526 E343G probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Atp1b1 G T 1: 164,453,515 T11K probably benign Het
Calr3 A G 8: 72,434,839 L40S probably damaging Het
Ccar1 A C 10: 62,745,287 D1119E unknown Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cdk12 T G 11: 98,210,638 S441A unknown Het
Ces4a T A 8: 105,146,114 V333E probably damaging Het
Cfap61 T C 2: 146,214,680 L1193P probably damaging Het
Chd2 A T 7: 73,478,668 D856E probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cln3 T A 7: 126,579,218 H211L probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dcstamp T A 15: 39,754,312 V39E probably damaging Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Duox1 A G 2: 122,344,713 T1331A probably benign Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Fcer2a T C 8: 3,688,557 E60G possibly damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Fnbp1l A T 3: 122,546,962 M463K probably benign Het
Garem2 A G 5: 30,114,764 D408G probably benign Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Il15ra T A 2: 11,718,344 probably null Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Knstrn T A 2: 118,830,975 probably null Het
Letm1 C A 5: 33,769,486 V156L possibly damaging Het
Lrrc24 G A 15: 76,722,911 P95L probably damaging Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Me3 T C 7: 89,850,381 Y535H probably damaging Het
Nfatc2ip T C 7: 126,391,295 E178G probably benign Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr164 C T 16: 19,286,297 A149T probably benign Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pid1 T A 1: 84,038,438 I69F probably damaging Het
Pkhd1 A G 1: 20,537,360 S1091P probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Plxnd1 T C 6: 115,962,764 N1418S probably benign Het
Pmm1 T C 15: 81,956,400 T82A probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,650 T913M possibly damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Rbm8a2 T C 1: 175,978,854 E19G possibly damaging Het
Rgs3 T C 4: 62,690,504 S336P probably damaging Het
Serpina11 G T 12: 103,985,974 T179K probably damaging Het
Serpina1f T C 12: 103,693,396 N209S possibly damaging Het
Serpinf2 G A 11: 75,436,762 T159I probably benign Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc22a20 A T 19: 5,971,525 I483N possibly damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tex45 A T 8: 3,479,028 D201V probably benign Het
Tln1 C T 4: 43,553,083 probably null Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tmx3 T C 18: 90,527,913 F206S probably damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trappc10 A G 10: 78,199,042 probably null Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r53 T A 7: 12,601,439 Y98F probably damaging Het
Vmn2r58 T A 7: 41,864,170 N350Y probably benign Het
Vmn2r82 A T 10: 79,356,685 H32L probably benign Het
Wsb1 T C 11: 79,240,386 I395V probably benign Het
Zfat T C 15: 68,179,860 D695G probably benign Het
Zfp358 G T 8: 3,496,995 V526F possibly damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Other mutations in Olfr714
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Olfr714 APN 7 107074493 missense probably damaging 0.98
IGL02562:Olfr714 APN 7 107074562 missense probably benign 0.03
IGL02597:Olfr714 APN 7 107074439 missense possibly damaging 0.89
IGL02598:Olfr714 APN 7 107074716 missense possibly damaging 0.64
IGL02981:Olfr714 APN 7 107074551 missense probably damaging 1.00
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0518:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R0521:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R1661:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R1665:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R2069:Olfr714 UTSW 7 107074619 nonsense probably null
R3884:Olfr714 UTSW 7 107073903 missense possibly damaging 0.72
R4362:Olfr714 UTSW 7 107074592 missense probably damaging 0.99
R4618:Olfr714 UTSW 7 107074554 missense probably damaging 1.00
R5375:Olfr714 UTSW 7 107073873 missense probably benign 0.05
R5654:Olfr714 UTSW 7 107074187 missense probably damaging 1.00
R6228:Olfr714 UTSW 7 107074136 missense probably damaging 1.00
Z1088:Olfr714 UTSW 7 107074405 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCTGATTGCCCAGGACACAAG -3'
(R):5'- TGAACATAGGATCAGCAGGC -3'

Sequencing Primer
(F):5'- GACACAAGCATCTCCTTCCTGG -3'
(R):5'- CAGGCAGGGTATCATGACAACC -3'
Posted On2014-10-02