Incidental Mutation 'R2202:Ces4a'
ID238756
Institutional Source Beutler Lab
Gene Symbol Ces4a
Ensembl Gene ENSMUSG00000060560
Gene Namecarboxylesterase 4A
SynonymsCes8
MMRRC Submission 040204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2202 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105131800-105150109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105146114 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 333 (V333E)
Ref Sequence ENSEMBL: ENSMUSP00000125062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161289]
Predicted Effect probably damaging
Transcript: ENSMUST00000161289
AA Change: V333E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125062
Gene: ENSMUSG00000060560
AA Change: V333E

DomainStartEndE-ValueType
Pfam:COesterase 8 554 4.9e-163 PFAM
Pfam:Abhydrolase_3 143 319 2e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,668 V249A possibly damaging Het
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abca14 T C 7: 120,289,541 Y1237H probably benign Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
AI987944 T C 7: 41,374,526 E343G probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Atp1b1 G T 1: 164,453,515 T11K probably benign Het
Calr3 A G 8: 72,434,839 L40S probably damaging Het
Ccar1 A C 10: 62,745,287 D1119E unknown Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cdk12 T G 11: 98,210,638 S441A unknown Het
Cfap61 T C 2: 146,214,680 L1193P probably damaging Het
Chd2 A T 7: 73,478,668 D856E probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cln3 T A 7: 126,579,218 H211L probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dcstamp T A 15: 39,754,312 V39E probably damaging Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Duox1 A G 2: 122,344,713 T1331A probably benign Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Fcer2a T C 8: 3,688,557 E60G possibly damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Fnbp1l A T 3: 122,546,962 M463K probably benign Het
Garem2 A G 5: 30,114,764 D408G probably benign Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Il15ra T A 2: 11,718,344 probably null Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Knstrn T A 2: 118,830,975 probably null Het
Letm1 C A 5: 33,769,486 V156L possibly damaging Het
Lrrc24 G A 15: 76,722,911 P95L probably damaging Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Me3 T C 7: 89,850,381 Y535H probably damaging Het
Nfatc2ip T C 7: 126,391,295 E178G probably benign Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr164 C T 16: 19,286,297 A149T probably benign Het
Olfr714 T A 7: 107,074,316 W163R probably damaging Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pid1 T A 1: 84,038,438 I69F probably damaging Het
Pkhd1 A G 1: 20,537,360 S1091P probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Plxnd1 T C 6: 115,962,764 N1418S probably benign Het
Pmm1 T C 15: 81,956,400 T82A probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,650 T913M possibly damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Rbm8a2 T C 1: 175,978,854 E19G possibly damaging Het
Rgs3 T C 4: 62,690,504 S336P probably damaging Het
Serpina11 G T 12: 103,985,974 T179K probably damaging Het
Serpina1f T C 12: 103,693,396 N209S possibly damaging Het
Serpinf2 G A 11: 75,436,762 T159I probably benign Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc22a20 A T 19: 5,971,525 I483N possibly damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tex45 A T 8: 3,479,028 D201V probably benign Het
Tln1 C T 4: 43,553,083 probably null Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tmx3 T C 18: 90,527,913 F206S probably damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trappc10 A G 10: 78,199,042 probably null Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r53 T A 7: 12,601,439 Y98F probably damaging Het
Vmn2r58 T A 7: 41,864,170 N350Y probably benign Het
Vmn2r82 A T 10: 79,356,685 H32L probably benign Het
Wsb1 T C 11: 79,240,386 I395V probably benign Het
Zfat T C 15: 68,179,860 D695G probably benign Het
Zfp358 G T 8: 3,496,995 V526F possibly damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Other mutations in Ces4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Ces4a APN 8 105145163 missense probably benign 0.00
IGL01574:Ces4a APN 8 105145227 splice site probably benign
IGL01655:Ces4a APN 8 105147174 missense probably damaging 0.99
IGL03092:Ces4a APN 8 105148204 splice site probably benign
IGL03151:Ces4a APN 8 105148197 critical splice donor site probably null
F6893:Ces4a UTSW 8 105147227 missense possibly damaging 0.74
R0266:Ces4a UTSW 8 105141966 missense probably benign
R0659:Ces4a UTSW 8 105144922 splice site probably benign
R1239:Ces4a UTSW 8 105149498 missense probably damaging 1.00
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1505:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1509:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1598:Ces4a UTSW 8 105142821 missense probably damaging 1.00
R1734:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1736:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1737:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1738:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1744:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1789:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1951:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1953:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2126:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2129:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R4512:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R4865:Ces4a UTSW 8 105147158 missense probably benign 0.05
R4934:Ces4a UTSW 8 105137981 missense probably benign 0.30
R4936:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R5255:Ces4a UTSW 8 105142489 missense probably benign 0.00
R5342:Ces4a UTSW 8 105146143 missense probably benign 0.07
R5647:Ces4a UTSW 8 105146080 missense probably benign 0.10
R6062:Ces4a UTSW 8 105138174 critical splice donor site probably null
R6490:Ces4a UTSW 8 105149458 missense probably benign 0.09
R6606:Ces4a UTSW 8 105149378 missense possibly damaging 0.95
R6876:Ces4a UTSW 8 105144992 missense possibly damaging 0.56
R6901:Ces4a UTSW 8 105146698 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTCCTGAGTATCACTACCGG -3'
(R):5'- TTTTGCATCCTCAATGGGGC -3'

Sequencing Primer
(F):5'- TGAGTATCACTACCGGTAATCTCAC -3'
(R):5'- TCAATGGGGCCACTACGATCTG -3'
Posted On2014-10-02