Incidental Mutation 'R2202:Adamts7'
ID238757
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
SynonymsADAM-TS7
MMRRC Submission 040204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R2202 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location90163069-90208071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90180676 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 394 (K394N)
Ref Sequence ENSEMBL: ENSMUSP00000129292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113059
AA Change: K394N

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: K394N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113060
AA Change: K394N

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: K394N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134996
AA Change: K394N

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363
AA Change: K394N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000147250
AA Change: K394N

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: K394N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167122
AA Change: K394N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: K394N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,668 V249A possibly damaging Het
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abca14 T C 7: 120,289,541 Y1237H probably benign Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
AI987944 T C 7: 41,374,526 E343G probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Atp1b1 G T 1: 164,453,515 T11K probably benign Het
Calr3 A G 8: 72,434,839 L40S probably damaging Het
Ccar1 A C 10: 62,745,287 D1119E unknown Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cdk12 T G 11: 98,210,638 S441A unknown Het
Ces4a T A 8: 105,146,114 V333E probably damaging Het
Cfap61 T C 2: 146,214,680 L1193P probably damaging Het
Chd2 A T 7: 73,478,668 D856E probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cln3 T A 7: 126,579,218 H211L probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dcstamp T A 15: 39,754,312 V39E probably damaging Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Duox1 A G 2: 122,344,713 T1331A probably benign Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Fcer2a T C 8: 3,688,557 E60G possibly damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Fnbp1l A T 3: 122,546,962 M463K probably benign Het
Garem2 A G 5: 30,114,764 D408G probably benign Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Il15ra T A 2: 11,718,344 probably null Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Knstrn T A 2: 118,830,975 probably null Het
Letm1 C A 5: 33,769,486 V156L possibly damaging Het
Lrrc24 G A 15: 76,722,911 P95L probably damaging Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Me3 T C 7: 89,850,381 Y535H probably damaging Het
Nfatc2ip T C 7: 126,391,295 E178G probably benign Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr164 C T 16: 19,286,297 A149T probably benign Het
Olfr714 T A 7: 107,074,316 W163R probably damaging Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pid1 T A 1: 84,038,438 I69F probably damaging Het
Pkhd1 A G 1: 20,537,360 S1091P probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Plxnd1 T C 6: 115,962,764 N1418S probably benign Het
Pmm1 T C 15: 81,956,400 T82A probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,650 T913M possibly damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Rbm8a2 T C 1: 175,978,854 E19G possibly damaging Het
Rgs3 T C 4: 62,690,504 S336P probably damaging Het
Serpina11 G T 12: 103,985,974 T179K probably damaging Het
Serpina1f T C 12: 103,693,396 N209S possibly damaging Het
Serpinf2 G A 11: 75,436,762 T159I probably benign Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc22a20 A T 19: 5,971,525 I483N possibly damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tex45 A T 8: 3,479,028 D201V probably benign Het
Tln1 C T 4: 43,553,083 probably null Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tmx3 T C 18: 90,527,913 F206S probably damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trappc10 A G 10: 78,199,042 probably null Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r53 T A 7: 12,601,439 Y98F probably damaging Het
Vmn2r58 T A 7: 41,864,170 N350Y probably benign Het
Vmn2r82 A T 10: 79,356,685 H32L probably benign Het
Wsb1 T C 11: 79,240,386 I395V probably benign Het
Zfat T C 15: 68,179,860 D695G probably benign Het
Zfp358 G T 8: 3,496,995 V526F possibly damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90188798 splice site probably benign
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90194010 missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4661:Adamts7 UTSW 9 90193330 missense probably benign 0.02
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90188694 missense probably benign 0.20
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 intron probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAAACCCAGGGAATACTGC -3'
(R):5'- CACACTCCTTGGTACTGCAACC -3'

Sequencing Primer
(F):5'- TCAAGGTCATGCAGCCATTG -3'
(R):5'- TGGTACTGCAACCCTCCACG -3'
Posted On2014-10-02