Incidental Mutation 'R2202:Dicer1'
ID238776
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Namedicer 1, ribonuclease type III
SynonymsD12Ertd7e
MMRRC Submission 040204-MU
Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2202 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104687742-104751952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104731038 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 87 (V87M)
Ref Sequence ENSEMBL: ENSMUSP00000152413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987] [ENSMUST00000222002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041987
AA Change: V87M

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: V87M

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221293
Predicted Effect probably damaging
Transcript: ENSMUST00000222002
AA Change: V87M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,668 V249A possibly damaging Het
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abca14 T C 7: 120,289,541 Y1237H probably benign Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
AI987944 T C 7: 41,374,526 E343G probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Atp1b1 G T 1: 164,453,515 T11K probably benign Het
Calr3 A G 8: 72,434,839 L40S probably damaging Het
Ccar1 A C 10: 62,745,287 D1119E unknown Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cdk12 T G 11: 98,210,638 S441A unknown Het
Ces4a T A 8: 105,146,114 V333E probably damaging Het
Cfap61 T C 2: 146,214,680 L1193P probably damaging Het
Chd2 A T 7: 73,478,668 D856E probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cln3 T A 7: 126,579,218 H211L probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dcstamp T A 15: 39,754,312 V39E probably damaging Het
Duox1 A G 2: 122,344,713 T1331A probably benign Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Fcer2a T C 8: 3,688,557 E60G possibly damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Fnbp1l A T 3: 122,546,962 M463K probably benign Het
Garem2 A G 5: 30,114,764 D408G probably benign Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Il15ra T A 2: 11,718,344 probably null Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Knstrn T A 2: 118,830,975 probably null Het
Letm1 C A 5: 33,769,486 V156L possibly damaging Het
Lrrc24 G A 15: 76,722,911 P95L probably damaging Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Me3 T C 7: 89,850,381 Y535H probably damaging Het
Nfatc2ip T C 7: 126,391,295 E178G probably benign Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr164 C T 16: 19,286,297 A149T probably benign Het
Olfr714 T A 7: 107,074,316 W163R probably damaging Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pid1 T A 1: 84,038,438 I69F probably damaging Het
Pkhd1 A G 1: 20,537,360 S1091P probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Plxnd1 T C 6: 115,962,764 N1418S probably benign Het
Pmm1 T C 15: 81,956,400 T82A probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,650 T913M possibly damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Rbm8a2 T C 1: 175,978,854 E19G possibly damaging Het
Rgs3 T C 4: 62,690,504 S336P probably damaging Het
Serpina11 G T 12: 103,985,974 T179K probably damaging Het
Serpina1f T C 12: 103,693,396 N209S possibly damaging Het
Serpinf2 G A 11: 75,436,762 T159I probably benign Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc22a20 A T 19: 5,971,525 I483N possibly damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tex45 A T 8: 3,479,028 D201V probably benign Het
Tln1 C T 4: 43,553,083 probably null Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tmx3 T C 18: 90,527,913 F206S probably damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trappc10 A G 10: 78,199,042 probably null Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r53 T A 7: 12,601,439 Y98F probably damaging Het
Vmn2r58 T A 7: 41,864,170 N350Y probably benign Het
Vmn2r82 A T 10: 79,356,685 H32L probably benign Het
Wsb1 T C 11: 79,240,386 I395V probably benign Het
Zfat T C 15: 68,179,860 D695G probably benign Het
Zfp358 G T 8: 3,496,995 V526F possibly damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104696772 missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104706327 missense probably null 0.75
IGL01527:Dicer1 APN 12 104691610 nonsense probably null
IGL01597:Dicer1 APN 12 104705210 nonsense probably null
IGL01636:Dicer1 APN 12 104722241 missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104702787 nonsense probably null
IGL01765:Dicer1 APN 12 104706740 missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104704180 missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104702553 missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104697020 missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104697035 missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104714832 missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104705129 missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104714906 missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104713107 missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104712197 missense probably damaging 0.98
everest UTSW 12 104705128 missense probably damaging 1.00
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0032:Dicer1 UTSW 12 104704798 nonsense probably null
R0219:Dicer1 UTSW 12 104692125 critical splice donor site probably null
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0242:Dicer1 UTSW 12 104702451 missense probably benign 0.02
R0385:Dicer1 UTSW 12 104704174 missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104731064 missense probably benign 0.04
R0426:Dicer1 UTSW 12 104702542 missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104702630 missense probably benign
R0502:Dicer1 UTSW 12 104705060 missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104691658 missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104702841 missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104702491 missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104706301 missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104706864 missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104706885 missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104691607 missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104729142 missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104729243 missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104721969 critical splice donor site probably null
R1642:Dicer1 UTSW 12 104713156 missense probably damaging 1.00
R1651:Dicer1 UTSW 12 104708805 missense probably damaging 1.00
R1658:Dicer1 UTSW 12 104700414 missense probably benign
R1815:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104722151 missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104702884 missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104713214 missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104722031 missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104702949 missense probably benign 0.17
R2203:Dicer1 UTSW 12 104731038 missense probably damaging 0.98
R2243:Dicer1 UTSW 12 104730188 missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104729228 missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104705114 missense probably damaging 1.00
R4482:Dicer1 UTSW 12 104706277 missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104704751 nonsense probably null
R4776:Dicer1 UTSW 12 104692446 missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104696591 missense probably benign 0.44
R4904:Dicer1 UTSW 12 104713066 missense probably benign
R5202:Dicer1 UTSW 12 104694731 nonsense probably null
R5272:Dicer1 UTSW 12 104704240 missense probably damaging 1.00
R5363:Dicer1 UTSW 12 104703151 missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104705128 missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104696462 missense probably benign 0.00
R6479:Dicer1 UTSW 12 104696723 missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104731023 missense probably damaging 1.00
X0018:Dicer1 UTSW 12 104696934 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATCTAAGAGAAACACAGAGTCTG -3'
(R):5'- TGTGGTGCCTGGCTAAGAAG -3'

Sequencing Primer
(F):5'- CACAGAGTCTGAACAATTGAGAG -3'
(R):5'- GCCTGGCTAAGAAGTATGTGATC -3'
Posted On2014-10-02