Incidental Mutation 'R2204:Cttnbp2'
ID238903
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 040206-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R2204 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18408694 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 976 (D976A)
Ref Sequence ENSEMBL: ENSMUSP00000088089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably benign
Transcript: ENSMUST00000090601
AA Change: D976A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: D976A

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141581
SMART Domains Protein: ENSMUSP00000123162
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
low complexity region 182 193 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146775
AA Change: D466A
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: D466A

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
A630076J17Rik A G 3: 107,233,627 probably benign Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Acsf3 C T 8: 122,813,644 S527F probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Bap1 T C 14: 31,256,701 V23A probably benign Het
C87499 A T 4: 88,628,118 L329Q probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Ceacam11 C T 7: 17,975,348 T157I possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Chrnb4 G A 9: 55,043,848 R44C probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Espl1 A G 15: 102,305,905 E693G probably damaging Het
Fat1 G T 8: 45,023,700 A1928S probably damaging Het
Fiz1 C T 7: 5,008,686 E278K probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Hlcs T C 16: 94,231,152 T451A probably benign Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ift52 G A 2: 163,031,230 S221N probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map3k14 T A 11: 103,239,454 K212N possibly damaging Het
Ndufb7 A G 8: 83,570,899 H61R probably damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr418 T A 1: 173,270,136 probably null Het
Olfr867 T C 9: 20,055,211 N84S possibly damaging Het
P3h4 G A 11: 100,414,006 A185V probably benign Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sars2 T C 7: 28,749,674 V302A possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Speg A T 1: 75,430,477 T3137S probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stard9 GAAA GAA 2: 120,698,531 probably null Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Taco1 C T 11: 106,071,934 A149V probably benign Het
Tenm3 T C 8: 48,674,550 E31G probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trabd2b T C 4: 114,602,994 L443P probably damaging Het
Trip4 T A 9: 65,864,265 I328F probably damaging Het
Trpc3 A G 3: 36,650,149 F553S possibly damaging Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCGATGCAGGAGTCAGTAG -3'
(R):5'- AACCAGTATTTGCTGCAGTACAAG -3'

Sequencing Primer
(F):5'- GCATTATTAAATGTCCCATCTTCCAG -3'
(R):5'- TTTGCTGCAGTACAAGAAGGCTC -3'
Posted On2014-10-02