Incidental Mutation 'R2204:Tenm3'
ID238912
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 040206-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R2204 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48674550 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 31 (E31G)
Ref Sequence ENSEMBL: ENSMUSP00000148666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840] [ENSMUST00000211812]
Predicted Effect probably benign
Transcript: ENSMUST00000033965
AA Change: E31G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: E31G

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000190840
AA Change: E31G
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: E31G

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211812
AA Change: E31G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
A630076J17Rik A G 3: 107,233,627 probably benign Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Acsf3 C T 8: 122,813,644 S527F probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Bap1 T C 14: 31,256,701 V23A probably benign Het
C87499 A T 4: 88,628,118 L329Q probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Ceacam11 C T 7: 17,975,348 T157I possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Chrnb4 G A 9: 55,043,848 R44C probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Espl1 A G 15: 102,305,905 E693G probably damaging Het
Fat1 G T 8: 45,023,700 A1928S probably damaging Het
Fiz1 C T 7: 5,008,686 E278K probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Hlcs T C 16: 94,231,152 T451A probably benign Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ift52 G A 2: 163,031,230 S221N probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map3k14 T A 11: 103,239,454 K212N possibly damaging Het
Ndufb7 A G 8: 83,570,899 H61R probably damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr418 T A 1: 173,270,136 probably null Het
Olfr867 T C 9: 20,055,211 N84S possibly damaging Het
P3h4 G A 11: 100,414,006 A185V probably benign Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sars2 T C 7: 28,749,674 V302A possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Speg A T 1: 75,430,477 T3137S probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stard9 GAAA GAA 2: 120,698,531 probably null Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Taco1 C T 11: 106,071,934 A149V probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trabd2b T C 4: 114,602,994 L443P probably damaging Het
Trip4 T A 9: 65,864,265 I328F probably damaging Het
Trpc3 A G 3: 36,650,149 F553S possibly damaging Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAACGCGTGCGGATACC -3'
(R):5'- TGCTTTCGCTGACGTCATGC -3'

Sequencing Primer
(F):5'- CGGATACCTTGTTCTACTAGAGCG -3'
(R):5'- GCTGACGTCATGCCAACC -3'
Posted On2014-10-02