Incidental Mutation 'R2205:Pdlim2'
ID239001
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene NamePDZ and LIM domain 2
SynonymsSLIM, 4732462F18Rik, mystique
MMRRC Submission 040207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2205 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70164218-70177681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70164779 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 296 (R296H)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: R97H
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: R97H

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127836
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129174
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
5830473C10Rik A G 5: 90,569,562 T201A possibly damaging Het
9930111J21Rik2 C G 11: 49,019,322 L761F probably damaging Het
Abca14 T C 7: 120,247,280 S652P probably damaging Het
Acsl6 G A 11: 54,324,007 G75S probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ahdc1 A G 4: 133,065,909 E1487G possibly damaging Het
Aknad1 A G 3: 108,757,293 D406G probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Arhgap35 A T 7: 16,498,025 probably null Het
Bag6 G A 17: 35,144,607 G751R probably damaging Het
Brat1 G A 5: 140,705,133 probably benign Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Catsperg1 G A 7: 29,185,246 Q922* probably null Het
Cfap221 T G 1: 119,936,104 Y570S possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cpd A G 11: 76,802,244 Y739H probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dhrs7 A T 12: 72,656,370 V188E probably damaging Het
Dpp9 A C 17: 56,199,287 I411S possibly damaging Het
Fitm2 G A 2: 163,472,596 probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm12169 A G 11: 46,528,567 N70S probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Gpatch1 C A 7: 35,291,772 D616Y probably damaging Het
Gpc3 T A X: 52,397,206 I344F probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Hoxb3 T A 11: 96,345,668 S191T probably benign Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Irak1 G A X: 74,017,138 T193I probably damaging Het
Megf8 C T 7: 25,341,748 T1134I probably benign Het
Nipsnap1 C A 11: 4,889,974 H232N possibly damaging Het
Nme4 A T 17: 26,092,140 H150Q possibly damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
P2rx7 T A 5: 122,681,101 Y529N probably damaging Het
Pofut1 T A 2: 153,261,247 M267K probably damaging Het
Rad54l2 T C 9: 106,717,798 D320G probably damaging Het
Rdm1 C A 11: 101,634,803 A225E probably damaging Het
Samm50 G A 15: 84,202,314 A245T probably benign Het
Scfd2 A T 5: 74,225,367 M597K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skiv2l2 T C 13: 112,898,890 I510V probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Tbc1d31 A G 15: 57,953,520 D717G probably benign Het
Tma7 C A 9: 109,082,226 probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Tns3 T C 11: 8,531,719 Y211C probably damaging Het
Ttc21b C T 2: 66,235,123 G436S possibly damaging Het
Ttn T C 2: 76,851,563 probably benign Het
Ube3b G A 5: 114,389,074 V118M probably damaging Het
Usp34 A G 11: 23,385,147 T1210A probably damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Wdr62 T A 7: 30,258,149 probably null Het
Ywhah A G 5: 33,027,140 N229S probably damaging Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Zmat1 A G X: 134,973,112 L476P possibly damaging Het
Zswim4 G T 8: 84,225,869 T488N possibly damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70166083 splice site probably benign
IGL02338:Pdlim2 APN 14 70174457 missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70174476 missense possibly damaging 0.88
R0751:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70174324 splice site probably benign
R1595:Pdlim2 UTSW 14 70164744 missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70171239 missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70174335 critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70171249 missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70166100 missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70168015 unclassified probably benign
R4971:Pdlim2 UTSW 14 70167759 missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70167780 missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70167688 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCAGTATAATCATGTCTGCAG -3'
(R):5'- GGGGTTGGTAAAATGAAATTCCTG -3'

Sequencing Primer
(F):5'- AATCATGTCTGCAGAGTCTGAG -3'
(R):5'- AAATTCCTGAGAGAGAGGCTTTTG -3'
Posted On2014-10-02