Mutagenetix > Incidental Mutation

Incidental Mutation 'R2205:Tnfsf14'

239009

Institutional Source

Beutler Lab

Gene Symbol

Tnfsf14

Ensembl Gene

ENSMUSG00000005824

Gene Name

tumor necrosis factor (ligand) superfamily, member 14

Synonyms

LIGHT, HVEM-L

MMRRC Submission

040207-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R2205 (G1)

Quality Score

179

Status

Not validated

Chromosome

Chromosomal Location

57496492-57501177 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57497638 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 198 (D198G)

Ref Sequence

ENSEMBL: ENSMUSP00000005976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005976]

AlphaFold

Q9QYH9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005976
AA Change: D198G

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000005976
Gene: ENSMUSG00000005824
AA Change: D198G

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
TNF	92	239	1.22e-49	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene leads to selective impairment of CD8+ T cell function. Mice homozygous for a knock-out allele exhibit defects in CD8+ T cell-mediated allogenic responses. Mice homozygous for a different knock-out allele show increased resistance to experimentally-induced hepatitis. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	C	G	11: 48,910,149 (GRCm39)	L761F	probably damaging	Het
Abca14	T	C	7: 119,846,503 (GRCm39)	S652P	probably damaging	Het
Acsl6	G	A	11: 54,214,833 (GRCm39)	G75S	probably damaging	Het
Adamts7	A	T	9: 90,062,729 (GRCm39)	K394N	probably damaging	Het
Ahdc1	A	G	4: 132,793,220 (GRCm39)	E1487G	possibly damaging	Het
Aknad1	A	G	3: 108,664,609 (GRCm39)	D406G	probably damaging	Het
Albfm1	A	G	5: 90,717,421 (GRCm39)	T201A	possibly damaging	Het
Ankrd2	C	A	19: 42,032,558 (GRCm39)	A273E	probably damaging	Het
Ankrd26	T	A	6: 118,500,843 (GRCm39)	H876L	possibly damaging	Het
Arhgap35	A	T	7: 16,231,950 (GRCm39)		probably null	Het
Bag6	G	A	17: 35,363,583 (GRCm39)	G751R	probably damaging	Het
Brat1	G	A	5: 140,690,888 (GRCm39)		probably benign	Het
Cacna1h	C	T	17: 25,599,234 (GRCm39)	A1742T	probably damaging	Het
Catsperg1	G	A	7: 28,884,671 (GRCm39)	Q922*	probably null	Het
Cfap221	T	G	1: 119,863,834 (GRCm39)	Y570S	possibly damaging	Het
Cfap45	T	C	1: 172,359,728 (GRCm39)	V76A	probably benign	Het
Chil3	T	C	3: 106,071,562 (GRCm39)	D34G	probably benign	Het
Cpa1	A	G	6: 30,641,818 (GRCm39)	D214G	probably damaging	Het
Cpd	A	G	11: 76,693,070 (GRCm39)	Y739H	probably damaging	Het
Cttnbp2	T	G	6: 18,408,693 (GRCm39)	D976A	probably benign	Het
Dhrs7	A	T	12: 72,703,144 (GRCm39)	V188E	probably damaging	Het
Dpp9	A	C	17: 56,506,287 (GRCm39)	I411S	possibly damaging	Het
Elapor1	C	T	3: 108,382,359 (GRCm39)	G270E	probably damaging	Het
Fitm2	G	A	2: 163,314,516 (GRCm39)		probably benign	Het
Flnc	C	T	6: 29,459,507 (GRCm39)	P2536S	probably damaging	Het
Gm6370	T	A	5: 146,430,539 (GRCm39)	D241E	probably benign	Het
Gpatch1	C	A	7: 34,991,197 (GRCm39)	D616Y	probably damaging	Het
Gpc3	T	A	X: 51,486,083 (GRCm39)	I344F	probably damaging	Het
Hmgcs2	T	A	3: 98,198,499 (GRCm39)	I134N	probably damaging	Het
Hoxb3	T	A	11: 96,236,494 (GRCm39)	S191T	probably benign	Het
Ifit1bl1	C	T	19: 34,571,741 (GRCm39)	E239K	probably benign	Het
Ints8	A	T	4: 11,225,712 (GRCm39)	M615K	possibly damaging	Het
Irak1	G	A	X: 73,060,744 (GRCm39)	T193I	probably damaging	Het
Megf8	C	T	7: 25,041,173 (GRCm39)	T1134I	probably benign	Het
Mtrex	T	C	13: 113,035,424 (GRCm39)	I510V	probably benign	Het
Nipsnap1	C	A	11: 4,839,974 (GRCm39)	H232N	possibly damaging	Het
Nme4	A	T	17: 26,311,114 (GRCm39)	H150Q	possibly damaging	Het
Nudt5	A	T	2: 5,860,794 (GRCm39)	I22F	possibly damaging	Het
P2rx7	T	A	5: 122,819,164 (GRCm39)	Y529N	probably damaging	Het
Pdlim2	C	T	14: 70,402,228 (GRCm39)	R296H	probably damaging	Het
Pofut1	T	A	2: 153,103,167 (GRCm39)	M267K	probably damaging	Het
Rad54l2	T	C	9: 106,594,997 (GRCm39)	D320G	probably damaging	Het
Rdm1	C	A	11: 101,525,629 (GRCm39)	A225E	probably damaging	Het
Samm50	G	A	15: 84,086,515 (GRCm39)	A245T	probably benign	Het
Scfd2	A	T	5: 74,386,028 (GRCm39)	M597K	possibly damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Ssh3	A	G	19: 4,319,101 (GRCm39)	L3P	probably damaging	Het
Stoml2	G	T	4: 43,030,243 (GRCm39)	Y119*	probably null	Het
Tbc1d31	A	G	15: 57,816,916 (GRCm39)	D717G	probably benign	Het
Timd5	A	G	11: 46,419,394 (GRCm39)	N70S	probably benign	Het
Tma7	C	A	9: 108,911,294 (GRCm39)		probably benign	Het
Tmc1	A	T	19: 20,918,269 (GRCm39)	L2M	probably benign	Het
Tmem39b	A	C	4: 129,587,716 (GRCm39)	S32A	probably benign	Het
Tns3	T	C	11: 8,481,719 (GRCm39)	Y211C	probably damaging	Het
Ttc21b	C	T	2: 66,065,467 (GRCm39)	G436S	possibly damaging	Het
Ttn	T	C	2: 76,681,907 (GRCm39)		probably benign	Het
Ube3b	G	A	5: 114,527,135 (GRCm39)	V118M	probably damaging	Het
Usp34	A	G	11: 23,335,147 (GRCm39)	T1210A	probably damaging	Het
Vmn1r23	T	C	6: 57,903,604 (GRCm39)	D58G	probably benign	Het
Vmn2r104	A	T	17: 20,250,083 (GRCm39)	N729K	probably benign	Het
Wdr62	T	A	7: 29,957,574 (GRCm39)		probably null	Het
Ywhah	A	G	5: 33,184,484 (GRCm39)	N229S	probably damaging	Het
Zbtb47	A	G	9: 121,591,703 (GRCm39)	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,171,885 (GRCm39)	A139D	probably damaging	Het
Zmat1	A	G	X: 133,873,861 (GRCm39)	L476P	possibly damaging	Het
Zswim4	G	T	8: 84,952,498 (GRCm39)	T488N	possibly damaging	Het

Other mutations in Tnfsf14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Tnfsf14	APN	17	57,499,562 (GRCm39)	missense	possibly damaging	0.89
IGL00962:Tnfsf14	APN	17	57,499,906 (GRCm39)	nonsense	probably null
IGL02515:Tnfsf14	APN	17	57,499,600 (GRCm39)	missense	probably benign
P0015:Tnfsf14	UTSW	17	57,497,815 (GRCm39)	missense	probably damaging	1.00
R1435:Tnfsf14	UTSW	17	57,497,605 (GRCm39)	missense	possibly damaging	0.60
R1566:Tnfsf14	UTSW	17	57,500,876 (GRCm39)	missense	probably benign
R1791:Tnfsf14	UTSW	17	57,497,867 (GRCm39)	missense	probably damaging	1.00
R1967:Tnfsf14	UTSW	17	57,497,807 (GRCm39)	missense	probably damaging	1.00
R2108:Tnfsf14	UTSW	17	57,497,867 (GRCm39)	missense	probably damaging	1.00
R2202:Tnfsf14	UTSW	17	57,497,638 (GRCm39)	missense	possibly damaging	0.67
R2203:Tnfsf14	UTSW	17	57,497,638 (GRCm39)	missense	possibly damaging	0.67
R2204:Tnfsf14	UTSW	17	57,497,638 (GRCm39)	missense	possibly damaging	0.67
R2232:Tnfsf14	UTSW	17	57,500,876 (GRCm39)	missense	probably benign
R4790:Tnfsf14	UTSW	17	57,497,740 (GRCm39)	missense	probably damaging	1.00
R5434:Tnfsf14	UTSW	17	57,499,592 (GRCm39)	missense	probably benign	0.00
R7474:Tnfsf14	UTSW	17	57,497,848 (GRCm39)	missense
R7691:Tnfsf14	UTSW	17	57,501,024 (GRCm39)	missense	possibly damaging	0.92
R8499:Tnfsf14	UTSW	17	57,497,534 (GRCm39)	missense
R9330:Tnfsf14	UTSW	17	57,501,020 (GRCm39)	missense	probably damaging	1.00
Z1177:Tnfsf14	UTSW	17	57,501,089 (GRCm39)	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTTCAGGGCTCCTTAAAGGG -3'
(R):5'- TGTGTACTCCAAAGTGCAGC -3'

Sequencing Primer
(F):5'- GAGGACTTCAAACCCTATTGCTGG -3'
(R):5'- GTACTCCAAAGTGCAGCTGAGC -3'

Posted On

2014-10-02