Incidental Mutation 'R2206:Dhx8'
ID239064
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 8
SynonymsRNA helicase, Ddx8, mDEAH6
MMRRC Submission 040208-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R2206 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101732919-101767358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101750971 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 632 (T632A)
Ref Sequence ENSEMBL: ENSMUSP00000037251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
Predicted Effect probably benign
Transcript: ENSMUST00000039152
AA Change: T632A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: T632A

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129741
AA Change: T579A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: T579A

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141461
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2310057M21Rik A T 7: 131,362,602 C24S probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
Abhd18 G A 3: 40,910,573 G83D probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Adck2 A G 6: 39,583,839 D123G probably damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Armc4 C A 18: 7,223,676 G456W probably benign Het
Axl T C 7: 25,770,636 Y466C probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9a A T 2: 154,264,241 probably null Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Cstf2t A G 19: 31,083,775 N237S probably benign Het
Disp2 G T 2: 118,792,244 Q1152H probably benign Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dmxl1 T C 18: 49,894,094 S2090P probably benign Het
Dnajc13 C G 9: 104,203,518 V821L probably damaging Het
Dopey1 T A 9: 86,521,599 H1617Q probably benign Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Ephb4 T C 5: 137,357,719 C197R probably damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fpr3 A C 17: 17,970,646 T60P probably damaging Het
Gja4 A T 4: 127,312,617 S118T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kazn A T 4: 142,118,292 probably null Het
Mdn1 T C 4: 32,716,271 L2111P possibly damaging Het
Myo6 A G 9: 80,258,455 Y374C probably benign Het
Olfr1160 A G 2: 88,006,235 V181A probably benign Het
Olfr1451 A G 19: 12,999,040 D18G probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pcmtd1 A T 1: 7,169,583 I83L probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Prcp C T 7: 92,928,612 T328I probably damaging Het
Psg27 C A 7: 18,567,111 E6* probably null Het
Pth1r T A 9: 110,723,587 E465V probably damaging Het
Pus7l T C 15: 94,523,590 Y613C probably damaging Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Slc10a1 T C 12: 80,967,628 N106S probably damaging Het
Slc29a3 T C 10: 60,715,907 M453V possibly damaging Het
Slc4a8 T C 15: 100,807,445 V844A probably damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Tmppe C G 9: 114,405,572 P313R probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Trmt1l T C 1: 151,435,843 probably null Het
Vmn1r177 A T 7: 23,866,131 C107S probably damaging Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zbtb40 G A 4: 137,017,285 Q275* probably null Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101739807 missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101754826 missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101764027 critical splice donor site probably null
IGL02115:Dhx8 APN 11 101752388 missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101757606 missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101752004 splice site probably benign
IGL02697:Dhx8 APN 11 101754781 missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4342:Dhx8 UTSW 11 101738206 frame shift probably null
FR4449:Dhx8 UTSW 11 101738184 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738190 small deletion probably benign
FR4449:Dhx8 UTSW 11 101738194 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738206 small insertion probably benign
FR4449:Dhx8 UTSW 11 101738207 small insertion probably benign
FR4589:Dhx8 UTSW 11 101738188 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738179 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738182 small insertion probably benign
FR4737:Dhx8 UTSW 11 101738189 small insertion probably benign
R0402:Dhx8 UTSW 11 101752397 missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101763928 missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101739700 splice site probably benign
R1497:Dhx8 UTSW 11 101735387 intron probably benign
R1576:Dhx8 UTSW 11 101752319 missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101766738 missense probably damaging 1.00
R1773:Dhx8 UTSW 11 101752363 missense possibly damaging 0.87
R1941:Dhx8 UTSW 11 101752198 critical splice donor site probably null
R1954:Dhx8 UTSW 11 101753279 missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101762245 missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101738409 missense probably benign 0.06
R2148:Dhx8 UTSW 11 101738377 nonsense probably null
R2207:Dhx8 UTSW 11 101750971 missense probably benign 0.03
R4667:Dhx8 UTSW 11 101738161 missense unknown
R4678:Dhx8 UTSW 11 101739808 missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101738170 nonsense probably null
R4943:Dhx8 UTSW 11 101737700 nonsense probably null
R5341:Dhx8 UTSW 11 101738190 small deletion probably benign
R5586:Dhx8 UTSW 11 101733036 unclassified probably benign
R5662:Dhx8 UTSW 11 101766758 missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101740751 missense probably damaging 1.00
R6082:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101764313 missense probably damaging 1.00
R6415:Dhx8 UTSW 11 101737687 missense unknown
R6658:Dhx8 UTSW 11 101764922 missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101764792 missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101738421 nonsense probably null
R7011:Dhx8 UTSW 11 101741520 missense probably damaging 1.00
R7098:Dhx8 UTSW 11 101737768 critical splice donor site probably null
R7153:Dhx8 UTSW 11 101740175 intron probably null
R7284:Dhx8 UTSW 11 101754822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTACATTTCCCCAGCC -3'
(R):5'- ATGAAAATCTGCCTCCTTTGGG -3'

Sequencing Primer
(F):5'- ACCAGGTCTTCTATGAGAGTCCAG -3'
(R):5'- TCCTTTGGGAGAAATCTAAAAAGATG -3'
Posted On2014-10-02