Incidental Mutation 'R2207:Ccdc39'
ID239113
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Namecoiled-coil domain containing 39
Synonymsb2b2025.1Clo, b2b1735Clo, 4921507O14Rik, D3Ertd789e, b2b1304Clo
MMRRC Submission 040209-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R2207 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location33812362-33844310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33836733 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 241 (I241V)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000029222]
Predicted Effect probably damaging
Transcript: ENSMUST00000029222
AA Change: I241V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: I241V

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000029222
AA Change: I241V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: I241V

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200300
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abcb1b C T 5: 8,824,803 R488C probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Aicda T A 6: 122,561,285 V134D possibly damaging Het
Akt2 T A 7: 27,637,200 probably null Het
Aldh1a3 T C 7: 66,406,021 R341G probably damaging Het
Ankrd12 G T 17: 66,031,574 probably null Het
Anxa11 A G 14: 25,874,297 Y244C probably damaging Het
Atp2c2 G A 8: 119,748,309 R551Q probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bcl11a G T 11: 24,163,343 G229W probably damaging Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Ccdc9 A G 7: 16,284,269 probably benign Het
Cdk17 G A 10: 93,228,762 D298N probably damaging Het
Cdkl3 A G 11: 52,027,193 *354W probably null Het
Celf6 A T 9: 59,604,327 Y401F possibly damaging Het
Clec4a4 C T 6: 123,013,807 L169F probably damaging Het
Col14a1 T C 15: 55,463,686 F1411L unknown Het
Col4a2 G T 8: 11,443,352 G1354W probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp1 A G 1: 183,088,342 F838S possibly damaging Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dnah12 T A 14: 26,781,787 V1654E probably damaging Het
Dnah5 C T 15: 28,343,671 L2406F probably benign Het
Fam98b C G 2: 117,267,819 R257G probably damaging Het
Fbn2 A T 18: 58,081,399 C900* probably null Het
Fgf1 A G 18: 38,847,085 Y79H possibly damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fsip2 T G 2: 82,977,479 S1381A probably benign Het
Gtf2b G A 3: 142,778,320 G85D probably benign Het
Gyg C A 3: 20,150,539 G161C probably damaging Het
Hemgn G T 4: 46,396,301 L312I possibly damaging Het
Hic2 T C 16: 17,257,460 M51T possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hpx C T 7: 105,592,426 R287H probably damaging Het
Igf2bp3 C T 6: 49,088,554 G468E possibly damaging Het
Il5ra C A 6: 106,712,441 E397* probably null Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kdm2a A T 19: 4,362,870 D29E probably damaging Het
Lamc2 T G 1: 153,133,706 E784D possibly damaging Het
Lrp2 A T 2: 69,467,028 N3196K possibly damaging Het
Lyzl1 T A 18: 4,181,962 C96* probably null Het
Maf1 A G 15: 76,352,518 T17A probably benign Het
Map1b T C 13: 99,431,083 D1710G unknown Het
Megf8 C T 7: 25,349,797 T1773I probably damaging Het
Mei1 T C 15: 82,103,249 M414T probably benign Het
Myo15 A G 11: 60,506,034 N2643S probably benign Het
Ndufa9 A G 6: 126,844,809 Y64H probably damaging Het
Neb A T 2: 52,211,567 L4354* probably null Het
Nom1 T A 5: 29,439,974 I480N probably damaging Het
Nrxn3 C T 12: 89,348,312 T331M probably damaging Het
Olfr1307 A C 2: 111,944,925 F177C probably damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Olfr643 A G 7: 104,059,405 S66P probably damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pgm2l1 T A 7: 100,268,112 probably null Het
Pih1d2 C A 9: 50,621,079 H162N probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Pla2r1 C A 2: 60,458,435 V618F probably damaging Het
Plb1 T C 5: 32,316,640 S599P possibly damaging Het
Prkg1 T C 19: 30,578,860 D562G probably damaging Het
Proser1 T G 3: 53,478,391 S565A probably benign Het
Prx T A 7: 27,516,788 V238E probably damaging Het
Psapl1 T C 5: 36,205,165 I367T probably damaging Het
Rc3h1 T C 1: 160,940,025 V128A probably damaging Het
Rrm1 T A 7: 102,442,026 M1K probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Ryr2 A G 13: 11,810,937 S552P probably damaging Het
Sbf1 A G 15: 89,306,693 S225P possibly damaging Het
Serpina3c T A 12: 104,151,498 I194F probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a1 T A 6: 114,308,671 V356E probably damaging Het
Slfn1 A G 11: 83,121,166 E36G possibly damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Spag16 A G 1: 70,724,884 H621R probably benign Het
Tg G A 15: 66,681,939 G401D probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Ttn A T 2: 76,965,811 I590K probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zfp131 A T 13: 119,775,812 F303I probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp788 A T 7: 41,649,640 I567F probably damaging Het
Zfyve26 A G 12: 79,246,087 V2096A probably damaging Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33832568 missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33816958 unclassified probably benign
IGL02426:Ccdc39 APN 3 33825398 missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33825494 missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33830118 missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33837843 missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33844152 missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33819839 missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33844125 missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33815485 missense probably benign 0.34
R1370:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1385:Ccdc39 UTSW 3 33821412 missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33839145 missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33826480 missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33819896 missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33815501 missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33821432 missense possibly damaging 0.46
R2208:Ccdc39 UTSW 3 33841178 missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33815484 missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33837838 missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33814497 missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33819895 missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33825479 missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33837882 missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33826522 missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33814668 missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33819806 critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33813078 missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33839093 synonymous probably null
R5236:Ccdc39 UTSW 3 33830102 missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33825550 missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33816937 missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33826561 missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33841192 splice site probably null
R6375:Ccdc39 UTSW 3 33814367 missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33837959 missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33830093 missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33819868 missense probably damaging 1.00
R7183:Ccdc39 UTSW 3 33814471 missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33830105 missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33832676 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGACTTTCAAACAGCAGCATGC -3'
(R):5'- CCAAGGCGATATTTGCAAAAGC -3'

Sequencing Primer
(F):5'- CTGGCTGTCCTGGAACTAAATAGAC -3'
(R):5'- GGCGATATTTGCAAAAGCATTTAG -3'
Posted On2014-10-02