Incidental Mutation 'R0183:Eef1e1'
ID23912
Institutional Source Beutler Lab
Gene Symbol Eef1e1
Ensembl Gene ENSMUSG00000001707
Gene Nameeukaryotic translation elongation factor 1 epsilon 1
Synonyms
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0183 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location38644207-38659058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38656186 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 48 (A48T)
Ref Sequence ENSEMBL: ENSMUSP00000001757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001757]
Predicted Effect probably damaging
Transcript: ENSMUST00000001757
AA Change: A48T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001757
Gene: ENSMUSG00000001707
AA Change: A48T

DomainStartEndE-ValueType
Pfam:GST_C_2 54 158 7.5e-8 PFAM
Pfam:GST_C_3 64 151 6.1e-10 PFAM
Pfam:GST_C 83 153 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224487
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display early embryonic lethality while heterozygous mice exhibit prenatal semi-lethality and a significantly increased incidence of spontaneous tumorigenesis after 15 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Eef1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Eef1e1 APN 13 38656036 splice site probably benign
PIT4431001:Eef1e1 UTSW 13 38658962 missense probably damaging 1.00
R1120:Eef1e1 UTSW 13 38658934 missense probably damaging 0.98
R1458:Eef1e1 UTSW 13 38656123 missense probably damaging 1.00
R1652:Eef1e1 UTSW 13 38656105 missense possibly damaging 0.90
R3841:Eef1e1 UTSW 13 38656191 missense probably damaging 1.00
R5779:Eef1e1 UTSW 13 38646273 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCTTCAGCAGAGTCTGGGTGTCTTC -3'
(R):5'- GAGCAGTCGTGGATTACTGCGTAATG -3'

Sequencing Primer
(F):5'- CTTTACTGGAGTGTCCATCTACTCG -3'
(R):5'- TGCTGTTAAGTTACAGACCAGACC -3'
Posted On2013-04-16