Incidental Mutation 'R2207:Dnah5'
ID239176
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Namedynein, axonemal, heavy chain 5
Synonymsb2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 040209-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R2207 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location28203752-28472052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28343671 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 2406 (L2406F)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: L2406F

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: L2406F

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abcb1b C T 5: 8,824,803 R488C probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Aicda T A 6: 122,561,285 V134D possibly damaging Het
Akt2 T A 7: 27,637,200 probably null Het
Aldh1a3 T C 7: 66,406,021 R341G probably damaging Het
Ankrd12 G T 17: 66,031,574 probably null Het
Anxa11 A G 14: 25,874,297 Y244C probably damaging Het
Atp2c2 G A 8: 119,748,309 R551Q probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bcl11a G T 11: 24,163,343 G229W probably damaging Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Ccdc39 T C 3: 33,836,733 I241V probably damaging Het
Ccdc9 A G 7: 16,284,269 probably benign Het
Cdk17 G A 10: 93,228,762 D298N probably damaging Het
Cdkl3 A G 11: 52,027,193 *354W probably null Het
Celf6 A T 9: 59,604,327 Y401F possibly damaging Het
Clec4a4 C T 6: 123,013,807 L169F probably damaging Het
Col14a1 T C 15: 55,463,686 F1411L unknown Het
Col4a2 G T 8: 11,443,352 G1354W probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp1 A G 1: 183,088,342 F838S possibly damaging Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dnah12 T A 14: 26,781,787 V1654E probably damaging Het
Fam98b C G 2: 117,267,819 R257G probably damaging Het
Fbn2 A T 18: 58,081,399 C900* probably null Het
Fgf1 A G 18: 38,847,085 Y79H possibly damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fsip2 T G 2: 82,977,479 S1381A probably benign Het
Gtf2b G A 3: 142,778,320 G85D probably benign Het
Gyg C A 3: 20,150,539 G161C probably damaging Het
Hemgn G T 4: 46,396,301 L312I possibly damaging Het
Hic2 T C 16: 17,257,460 M51T possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hpx C T 7: 105,592,426 R287H probably damaging Het
Igf2bp3 C T 6: 49,088,554 G468E possibly damaging Het
Il5ra C A 6: 106,712,441 E397* probably null Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kdm2a A T 19: 4,362,870 D29E probably damaging Het
Lamc2 T G 1: 153,133,706 E784D possibly damaging Het
Lrp2 A T 2: 69,467,028 N3196K possibly damaging Het
Lyzl1 T A 18: 4,181,962 C96* probably null Het
Maf1 A G 15: 76,352,518 T17A probably benign Het
Map1b T C 13: 99,431,083 D1710G unknown Het
Megf8 C T 7: 25,349,797 T1773I probably damaging Het
Mei1 T C 15: 82,103,249 M414T probably benign Het
Myo15 A G 11: 60,506,034 N2643S probably benign Het
Ndufa9 A G 6: 126,844,809 Y64H probably damaging Het
Neb A T 2: 52,211,567 L4354* probably null Het
Nom1 T A 5: 29,439,974 I480N probably damaging Het
Nrxn3 C T 12: 89,348,312 T331M probably damaging Het
Olfr1307 A C 2: 111,944,925 F177C probably damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Olfr643 A G 7: 104,059,405 S66P probably damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pgm2l1 T A 7: 100,268,112 probably null Het
Pih1d2 C A 9: 50,621,079 H162N probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Pla2r1 C A 2: 60,458,435 V618F probably damaging Het
Plb1 T C 5: 32,316,640 S599P possibly damaging Het
Prkg1 T C 19: 30,578,860 D562G probably damaging Het
Proser1 T G 3: 53,478,391 S565A probably benign Het
Prx T A 7: 27,516,788 V238E probably damaging Het
Psapl1 T C 5: 36,205,165 I367T probably damaging Het
Rc3h1 T C 1: 160,940,025 V128A probably damaging Het
Rrm1 T A 7: 102,442,026 M1K probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Ryr2 A G 13: 11,810,937 S552P probably damaging Het
Sbf1 A G 15: 89,306,693 S225P possibly damaging Het
Serpina3c T A 12: 104,151,498 I194F probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a1 T A 6: 114,308,671 V356E probably damaging Het
Slfn1 A G 11: 83,121,166 E36G possibly damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Spag16 A G 1: 70,724,884 H621R probably benign Het
Tg G A 15: 66,681,939 G401D probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Ttn A T 2: 76,965,811 I590K probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zfp131 A T 13: 119,775,812 F303I probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp788 A T 7: 41,649,640 I567F probably damaging Het
Zfyve26 A G 12: 79,246,087 V2096A probably damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28272342 missense probably benign
IGL00331:Dnah5 APN 15 28421620 missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28444218 missense probably benign 0.10
IGL00537:Dnah5 APN 15 28458702 critical splice donor site probably null
IGL01102:Dnah5 APN 15 28410003 critical splice donor site probably null
IGL01126:Dnah5 APN 15 28302399 missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28458656 missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28294913 splice site probably benign
IGL01353:Dnah5 APN 15 28233272 missense probably benign 0.00
IGL01372:Dnah5 APN 15 28230490 missense probably benign 0.00
IGL01390:Dnah5 APN 15 28411540 missense probably benign 0.00
IGL01446:Dnah5 APN 15 28326669 missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28229652 missense probably benign 0.01
IGL01592:Dnah5 APN 15 28236637 missense probably benign 0.01
IGL01594:Dnah5 APN 15 28311334 missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28367782 missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28449169 missense probably benign 0.06
IGL01904:Dnah5 APN 15 28307364 missense probably benign 0.09
IGL01913:Dnah5 APN 15 28313753 missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28290289 missense probably null 1.00
IGL01963:Dnah5 APN 15 28370536 missense probably benign 0.12
IGL02008:Dnah5 APN 15 28343552 missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28459118 critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28240041 splice site probably benign
IGL02114:Dnah5 APN 15 28397124 missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28247885 missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28299240 missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28340381 missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28219150 missense probably benign 0.09
IGL02626:Dnah5 APN 15 28307276 missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28289047 splice site probably benign
IGL02651:Dnah5 APN 15 28350622 missense probably benign 0.05
IGL02652:Dnah5 APN 15 28366187 missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28409296 missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28445143 missense probably benign 0.00
IGL02721:Dnah5 APN 15 28234243 critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28453212 missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28383625 missense probably benign 0.01
IGL02945:Dnah5 APN 15 28270426 missense probably benign 0.00
IGL02949:Dnah5 APN 15 28272185 missense probably benign 0.32
IGL02971:Dnah5 APN 15 28384461 missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28340325 missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28295399 missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28290163 missense probably benign 0.08
IGL03224:Dnah5 APN 15 28459154 missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28311148 missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28458649 missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28233295 critical splice donor site probably null
IGL03331:Dnah5 APN 15 28419940 missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28290141 missense probably benign 0.10
IGL03367:Dnah5 APN 15 28234327 missense possibly damaging 0.95
IGL02837:Dnah5 UTSW 15 28269400 missense probably benign
P0008:Dnah5 UTSW 15 28302387 missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28403473 missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28383577 missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28451517 missense probably benign 0.34
R0087:Dnah5 UTSW 15 28350613 missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28239934 missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0104:Dnah5 UTSW 15 28453353 missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28263679 missense probably benign 0.00
R0122:Dnah5 UTSW 15 28378363 missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28246319 missense probably benign 0.00
R0127:Dnah5 UTSW 15 28294925 missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28333070 missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28299110 missense probably benign 0.19
R0386:Dnah5 UTSW 15 28383581 missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28229541 missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28383599 missense probably benign 0.31
R0514:Dnah5 UTSW 15 28366321 missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28327779 missense probably benign
R0720:Dnah5 UTSW 15 28313861 missense probably null 0.98
R0731:Dnah5 UTSW 15 28311143 missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28444186 missense probably damaging 0.99
R0747:Dnah5 UTSW 15 28444187 missense possibly damaging 0.64
R0766:Dnah5 UTSW 15 28448487 missense probably null 0.89
R0849:Dnah5 UTSW 15 28263599 missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28302471 missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28343452 missense probably benign 0.01
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28246257 missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28313918 splice site probably benign
R1401:Dnah5 UTSW 15 28401913 missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28370409 missense probably benign
R1430:Dnah5 UTSW 15 28345857 missense probably benign 0.37
R1457:Dnah5 UTSW 15 28403542 critical splice donor site probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1560:Dnah5 UTSW 15 28420003 missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1603:Dnah5 UTSW 15 28294985 splice site probably benign
R1603:Dnah5 UTSW 15 28449180 missense probably benign 0.09
R1673:Dnah5 UTSW 15 28290148 missense probably benign
R1755:Dnah5 UTSW 15 28326636 missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28270426 missense probably benign 0.00
R1817:Dnah5 UTSW 15 28246400 nonsense probably null
R1819:Dnah5 UTSW 15 28246400 nonsense probably null
R1834:Dnah5 UTSW 15 28409124 missense probably benign 0.00
R1855:Dnah5 UTSW 15 28411669 missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28331713 nonsense probably null
R1871:Dnah5 UTSW 15 28331713 nonsense probably null
R1987:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28366270 missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28312388 splice site probably null
R2121:Dnah5 UTSW 15 28297005 splice site probably benign
R2128:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2129:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2151:Dnah5 UTSW 15 28444091 missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28252545 missense probably benign 0.00
R2231:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2232:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2282:Dnah5 UTSW 15 28327302 missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28387767 missense probably benign 0.25
R2339:Dnah5 UTSW 15 28313882 missense probably benign 0.00
R2437:Dnah5 UTSW 15 28307391 critical splice donor site probably null
R2696:Dnah5 UTSW 15 28278576 missense probably benign 0.00
R3156:Dnah5 UTSW 15 28438091 splice site probably benign
R3431:Dnah5 UTSW 15 28295267 missense probably benign 0.20
R3700:Dnah5 UTSW 15 28387791 missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28270420 missense probably benign 0.08
R3732:Dnah5 UTSW 15 28409122 missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28411510 missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28420998 missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28340298 nonsense probably null
R4075:Dnah5 UTSW 15 28293791 missense probably benign
R4245:Dnah5 UTSW 15 28219189 missense probably benign
R4254:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4255:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4392:Dnah5 UTSW 15 28289229 missense probably benign 0.19
R4552:Dnah5 UTSW 15 28397154 missense probably benign 0.19
R4574:Dnah5 UTSW 15 28367763 missense probably benign 0.05
R4577:Dnah5 UTSW 15 28289250 missense probably benign 0.06
R4587:Dnah5 UTSW 15 28304599 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28401953 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28419994 missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28295260 missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28372375 missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28420955 splice site probably null
R4767:Dnah5 UTSW 15 28270474 missense probably benign 0.02
R4857:Dnah5 UTSW 15 28345807 missense probably benign 0.00
R4883:Dnah5 UTSW 15 28343638 missense probably benign 0.00
R4889:Dnah5 UTSW 15 28235792 missense probably benign 0.01
R4946:Dnah5 UTSW 15 28326557 missense probably damaging 0.96
R4946:Dnah5 UTSW 15 28387904 missense probably damaging 1.00
R4947:Dnah5 UTSW 15 28272372 missense probably benign
R5033:Dnah5 UTSW 15 28421678 missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28408292 missense probably benign 0.00
R5175:Dnah5 UTSW 15 28448404 missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28311278 missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28272172 missense probably benign 0.41
R5272:Dnah5 UTSW 15 28350665 missense probably benign
R5308:Dnah5 UTSW 15 28229651 missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28311328 missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28384244 missense probably benign 0.41
R5398:Dnah5 UTSW 15 28293726 missense probably benign
R5596:Dnah5 UTSW 15 28343608 missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28419932 missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28302435 missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28421064 missense probably benign 0.03
R5741:Dnah5 UTSW 15 28246367 missense probably benign 0.11
R5754:Dnah5 UTSW 15 28401868 missense probably benign 0.01
R5763:Dnah5 UTSW 15 28311152 missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28313821 missense probably benign 0.00
R5836:Dnah5 UTSW 15 28383592 missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28290195 missense probably benign 0.00
R5864:Dnah5 UTSW 15 28297013 missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28234453 intron probably null
R5896:Dnah5 UTSW 15 28272060 missense probably benign
R5899:Dnah5 UTSW 15 28448367 missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28307327 missense probably benign 0.41
R5927:Dnah5 UTSW 15 28335718 missense probably benign 0.00
R5929:Dnah5 UTSW 15 28311207 missense probably benign 0.01
R5929:Dnah5 UTSW 15 28311208 missense probably damaging 1.00
R5931:Dnah5 UTSW 15 28453279 missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28458584 missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28234282 missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28299226 missense probably benign 0.09
R6016:Dnah5 UTSW 15 28327884 missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28230468 missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28270420 missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28233231 missense probably benign 0.05
R6146:Dnah5 UTSW 15 28459185 missense probably benign
R6154:Dnah5 UTSW 15 28204031 missense probably benign 0.15
R6164:Dnah5 UTSW 15 28378343 missense probably benign 0.08
R6266:Dnah5 UTSW 15 28335627 missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28372411 missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28349824 missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28438183 missense probably benign 0.10
R6564:Dnah5 UTSW 15 28367745 missense probably benign
R6607:Dnah5 UTSW 15 28445200 missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28409120 missense probably benign 0.03
R6633:Dnah5 UTSW 15 28293787 missense probably benign 0.27
R6647:Dnah5 UTSW 15 28403487 missense probably benign 0.02
R6782:Dnah5 UTSW 15 28449156 missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28233238 nonsense probably null
R6797:Dnah5 UTSW 15 28451463 missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28411515 missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28278624 missense probably benign 0.14
R6871:Dnah5 UTSW 15 28229640 missense probably benign 0.32
R6936:Dnah5 UTSW 15 28409268 missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28235720 missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28238592 missense probably benign
R7030:Dnah5 UTSW 15 28333062 missense probably benign 0.00
R7032:Dnah5 UTSW 15 28326650 missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28233248 missense probably benign 0.00
R7094:Dnah5 UTSW 15 28453336 missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28453264 missense probably benign 0.00
R7126:Dnah5 UTSW 15 28349837 missense probably benign 0.03
R7209:Dnah5 UTSW 15 28459225 missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28367838 missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28270470 missense probably null 0.33
X0011:Dnah5 UTSW 15 28408381 missense probably benign 0.16
X0018:Dnah5 UTSW 15 28269354 missense probably benign 0.00
X0022:Dnah5 UTSW 15 28270411 missense probably benign 0.01
X0023:Dnah5 UTSW 15 28384308 missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28470477 missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28366357 missense probably null 0.10
Z1088:Dnah5 UTSW 15 28384230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTTGGGTGACATCCAGG -3'
(R):5'- CCTATGAAGGGCAATAAGGGTC -3'

Sequencing Primer
(F):5'- ATGGTCCAGTTGATGCCATC -3'
(R):5'- CAATAAGGGTCTGAGCAGCCC -3'
Posted On2014-10-02