Incidental Mutation 'R0183:Appl1'
ID 23918
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms 7330406P05Rik, 2900057D21Rik
MMRRC Submission 038448-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R0183 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 26640943-26692567 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26684811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 79 (D79E)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
AlphaFold Q8K3H0
Predicted Effect probably damaging
Transcript: ENSMUST00000036570
AA Change: D79E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: D79E

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224406
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 77,034,082 (GRCm39) D490N probably benign Het
Aatf A T 11: 84,401,251 (GRCm39) probably null Het
Amer3 T A 1: 34,626,838 (GRCm39) I359K probably damaging Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Baz1a T A 12: 54,958,172 (GRCm39) E1026D probably damaging Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Card14 C T 11: 119,217,524 (GRCm39) R386C probably damaging Het
Cenpb T C 2: 131,020,373 (GRCm39) probably benign Het
Clcn4 G A 7: 7,298,090 (GRCm39) Q40* probably null Het
Clec16a T C 16: 10,377,886 (GRCm39) Y28H probably damaging Het
Cul4a T C 8: 13,183,790 (GRCm39) S393P probably damaging Het
Dcbld2 A G 16: 58,265,722 (GRCm39) D194G possibly damaging Het
Dnah6 C T 6: 73,059,906 (GRCm39) V2841I probably damaging Het
Eaf1 T A 14: 31,217,272 (GRCm39) L16Q probably damaging Het
Eef1e1 C T 13: 38,840,162 (GRCm39) A48T probably damaging Het
Exoc3l C A 8: 106,021,932 (GRCm39) R57L probably damaging Het
Faf1 A G 4: 109,792,807 (GRCm39) N593S probably benign Het
Fosb A G 7: 19,041,310 (GRCm39) I61T probably damaging Het
Fstl5 A C 3: 76,229,579 (GRCm39) I127L possibly damaging Het
Gas2l2 T A 11: 83,319,882 (GRCm39) M125L probably benign Het
Gcnt1 C T 19: 17,306,481 (GRCm39) D415N probably benign Het
Gtpbp4 A G 13: 9,024,997 (GRCm39) M531T probably benign Het
Gucy1b2 T A 14: 62,656,589 (GRCm39) K256M probably damaging Het
Igf2bp2 A T 16: 21,897,480 (GRCm39) Y244* probably null Het
Jkamp T C 12: 72,140,809 (GRCm39) I118T possibly damaging Het
Kalrn A T 16: 33,991,749 (GRCm39) probably null Het
Kcnma1 A T 14: 23,558,120 (GRCm39) D317E probably damaging Het
Lipo2 A T 19: 33,726,951 (GRCm39) probably null Het
Lrig3 T A 10: 125,846,061 (GRCm39) I830K probably damaging Het
Map3k4 A G 17: 12,454,015 (GRCm39) I1429T probably damaging Het
Mkks G A 2: 136,722,606 (GRCm39) L184F probably benign Het
Mmp19 C T 10: 128,634,872 (GRCm39) T424I possibly damaging Het
Mrps23 A G 11: 88,100,980 (GRCm39) E57G probably damaging Het
Myh7 T C 14: 55,216,333 (GRCm39) T1282A probably benign Het
Or2y10 A G 11: 49,455,675 (GRCm39) D309G probably benign Het
Or8k1 T A 2: 86,047,173 (GRCm39) S294C probably damaging Het
Phf19 T C 2: 34,801,214 (GRCm39) N75S probably damaging Het
Pink1 T G 4: 138,041,490 (GRCm39) H477P probably damaging Het
Ppp6r2 G A 15: 89,169,990 (GRCm39) C835Y probably damaging Het
Prkcq T C 2: 11,257,973 (GRCm39) I295T probably damaging Het
Ptpn13 T C 5: 103,664,274 (GRCm39) S421P probably benign Het
Ptpn6 A G 6: 124,705,914 (GRCm39) S77P probably damaging Het
Ptpre G T 7: 135,271,574 (GRCm39) M389I probably benign Het
Ranbp9 T C 13: 43,578,599 (GRCm39) D158G probably damaging Het
Sec14l3 C T 11: 4,025,547 (GRCm39) S357L probably benign Het
Slc1a6 A G 10: 78,627,067 (GRCm39) T135A probably damaging Het
Spef2 A T 15: 9,716,445 (GRCm39) D323E possibly damaging Het
Taf2 T A 15: 54,919,186 (GRCm39) K396N possibly damaging Het
Tcf12 A T 9: 71,824,309 (GRCm39) V94E probably damaging Het
Trim24 T A 6: 37,920,415 (GRCm39) I404N possibly damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26,671,433 (GRCm39) missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26,681,427 (GRCm39) splice site probably benign
IGL01633:Appl1 APN 14 26,684,795 (GRCm39) missense probably damaging 0.99
IGL01945:Appl1 APN 14 26,650,612 (GRCm39) missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26,647,909 (GRCm39) splice site probably benign
IGL02650:Appl1 APN 14 26,672,665 (GRCm39) missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26,671,418 (GRCm39) missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26,673,473 (GRCm39) missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26,650,600 (GRCm39) missense probably damaging 1.00
R0323:Appl1 UTSW 14 26,664,695 (GRCm39) missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26,662,213 (GRCm39) missense probably benign
R1213:Appl1 UTSW 14 26,665,950 (GRCm39) missense probably benign 0.27
R1277:Appl1 UTSW 14 26,649,813 (GRCm39) missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26,645,811 (GRCm39) missense probably damaging 1.00
R1856:Appl1 UTSW 14 26,649,706 (GRCm39) missense probably damaging 1.00
R1889:Appl1 UTSW 14 26,647,470 (GRCm39) splice site probably benign
R2145:Appl1 UTSW 14 26,671,576 (GRCm39) missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3722:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3917:Appl1 UTSW 14 26,650,561 (GRCm39) missense probably damaging 1.00
R4700:Appl1 UTSW 14 26,647,928 (GRCm39) missense probably benign 0.00
R5139:Appl1 UTSW 14 26,669,112 (GRCm39) missense probably benign 0.04
R5485:Appl1 UTSW 14 26,684,823 (GRCm39) missense probably damaging 1.00
R5536:Appl1 UTSW 14 26,645,737 (GRCm39) nonsense probably null
R5795:Appl1 UTSW 14 26,664,773 (GRCm39) missense probably benign 0.01
R7044:Appl1 UTSW 14 26,650,634 (GRCm39) missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26,685,617 (GRCm39) missense probably benign 0.01
R7447:Appl1 UTSW 14 26,681,409 (GRCm39) nonsense probably null
R7943:Appl1 UTSW 14 26,667,525 (GRCm39) missense probably benign 0.01
R8110:Appl1 UTSW 14 26,649,751 (GRCm39) nonsense probably null
R8129:Appl1 UTSW 14 26,671,466 (GRCm39) missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26,650,592 (GRCm39) missense probably benign 0.35
R8211:Appl1 UTSW 14 26,667,555 (GRCm39) missense probably benign 0.18
R8239:Appl1 UTSW 14 26,686,914 (GRCm39) missense probably damaging 0.99
R8379:Appl1 UTSW 14 26,647,372 (GRCm39) critical splice donor site probably null
R8464:Appl1 UTSW 14 26,674,985 (GRCm39) nonsense probably null
R8699:Appl1 UTSW 14 26,662,212 (GRCm39) missense probably benign
R9023:Appl1 UTSW 14 26,685,652 (GRCm39) missense possibly damaging 0.93
R9090:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9203:Appl1 UTSW 14 26,682,970 (GRCm39) nonsense probably null
R9227:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9230:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9243:Appl1 UTSW 14 26,649,710 (GRCm39) missense possibly damaging 0.62
R9271:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9378:Appl1 UTSW 14 26,649,784 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGAATAAACTcacacatgcacatgcac -3'
(R):5'- AAGGTTGCCGTCTGCTTTTCCA -3'

Sequencing Primer
(F):5'- cacacacatacatacactctcac -3'
(R):5'- aaatcctgcctgcctctg -3'
Posted On 2013-04-16