Incidental Mutation 'R2207:Ankrd12'
ID239192
Institutional Source Beutler Lab
Gene Symbol Ankrd12
Ensembl Gene ENSMUSG00000034647
Gene Nameankyrin repeat domain 12
Synonyms2900001A12Rik, GAC-1, ANCO-2
MMRRC Submission 040209-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R2207 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65967501-66077089 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 66031574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038116] [ENSMUST00000038116] [ENSMUST00000150766]
Predicted Effect probably null
Transcript: ENSMUST00000038116
SMART Domains Protein: ENSMUSP00000039035
Gene: ENSMUSG00000034647

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
ANK 184 213 8.78e-6 SMART
ANK 217 246 1.76e-5 SMART
ANK 250 279 7.64e-6 SMART
low complexity region 292 300 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
coiled coil region 459 497 N/A INTRINSIC
coiled coil region 639 676 N/A INTRINSIC
coiled coil region 725 752 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 999 1018 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
low complexity region 1182 1197 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000038116
SMART Domains Protein: ENSMUSP00000039035
Gene: ENSMUSG00000034647

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
ANK 184 213 8.78e-6 SMART
ANK 217 246 1.76e-5 SMART
ANK 250 279 7.64e-6 SMART
low complexity region 292 300 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
coiled coil region 459 497 N/A INTRINSIC
coiled coil region 639 676 N/A INTRINSIC
coiled coil region 725 752 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 999 1018 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
low complexity region 1182 1197 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143516
Predicted Effect probably null
Transcript: ENSMUST00000150766
SMART Domains Protein: ENSMUSP00000114237
Gene: ENSMUSG00000034647

DomainStartEndE-ValueType
low complexity region 78 98 N/A INTRINSIC
ANK 161 190 8.78e-6 SMART
ANK 194 223 1.76e-5 SMART
ANK 227 256 7.64e-6 SMART
low complexity region 269 277 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abcb1b C T 5: 8,824,803 R488C probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Aicda T A 6: 122,561,285 V134D possibly damaging Het
Akt2 T A 7: 27,637,200 probably null Het
Aldh1a3 T C 7: 66,406,021 R341G probably damaging Het
Anxa11 A G 14: 25,874,297 Y244C probably damaging Het
Atp2c2 G A 8: 119,748,309 R551Q probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bcl11a G T 11: 24,163,343 G229W probably damaging Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Ccdc39 T C 3: 33,836,733 I241V probably damaging Het
Ccdc9 A G 7: 16,284,269 probably benign Het
Cdk17 G A 10: 93,228,762 D298N probably damaging Het
Cdkl3 A G 11: 52,027,193 *354W probably null Het
Celf6 A T 9: 59,604,327 Y401F possibly damaging Het
Clec4a4 C T 6: 123,013,807 L169F probably damaging Het
Col14a1 T C 15: 55,463,686 F1411L unknown Het
Col4a2 G T 8: 11,443,352 G1354W probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp1 A G 1: 183,088,342 F838S possibly damaging Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dnah12 T A 14: 26,781,787 V1654E probably damaging Het
Dnah5 C T 15: 28,343,671 L2406F probably benign Het
Fam98b C G 2: 117,267,819 R257G probably damaging Het
Fbn2 A T 18: 58,081,399 C900* probably null Het
Fgf1 A G 18: 38,847,085 Y79H possibly damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fsip2 T G 2: 82,977,479 S1381A probably benign Het
Gtf2b G A 3: 142,778,320 G85D probably benign Het
Gyg C A 3: 20,150,539 G161C probably damaging Het
Hemgn G T 4: 46,396,301 L312I possibly damaging Het
Hic2 T C 16: 17,257,460 M51T possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hpx C T 7: 105,592,426 R287H probably damaging Het
Igf2bp3 C T 6: 49,088,554 G468E possibly damaging Het
Il5ra C A 6: 106,712,441 E397* probably null Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kdm2a A T 19: 4,362,870 D29E probably damaging Het
Lamc2 T G 1: 153,133,706 E784D possibly damaging Het
Lrp2 A T 2: 69,467,028 N3196K possibly damaging Het
Lyzl1 T A 18: 4,181,962 C96* probably null Het
Maf1 A G 15: 76,352,518 T17A probably benign Het
Map1b T C 13: 99,431,083 D1710G unknown Het
Megf8 C T 7: 25,349,797 T1773I probably damaging Het
Mei1 T C 15: 82,103,249 M414T probably benign Het
Myo15 A G 11: 60,506,034 N2643S probably benign Het
Ndufa9 A G 6: 126,844,809 Y64H probably damaging Het
Neb A T 2: 52,211,567 L4354* probably null Het
Nom1 T A 5: 29,439,974 I480N probably damaging Het
Nrxn3 C T 12: 89,348,312 T331M probably damaging Het
Olfr1307 A C 2: 111,944,925 F177C probably damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Olfr643 A G 7: 104,059,405 S66P probably damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pgm2l1 T A 7: 100,268,112 probably null Het
Pih1d2 C A 9: 50,621,079 H162N probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Pla2r1 C A 2: 60,458,435 V618F probably damaging Het
Plb1 T C 5: 32,316,640 S599P possibly damaging Het
Prkg1 T C 19: 30,578,860 D562G probably damaging Het
Proser1 T G 3: 53,478,391 S565A probably benign Het
Prx T A 7: 27,516,788 V238E probably damaging Het
Psapl1 T C 5: 36,205,165 I367T probably damaging Het
Rc3h1 T C 1: 160,940,025 V128A probably damaging Het
Rrm1 T A 7: 102,442,026 M1K probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Ryr2 A G 13: 11,810,937 S552P probably damaging Het
Sbf1 A G 15: 89,306,693 S225P possibly damaging Het
Serpina3c T A 12: 104,151,498 I194F probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a1 T A 6: 114,308,671 V356E probably damaging Het
Slfn1 A G 11: 83,121,166 E36G possibly damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Spag16 A G 1: 70,724,884 H621R probably benign Het
Tg G A 15: 66,681,939 G401D probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Ttn A T 2: 76,965,811 I590K probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zfp131 A T 13: 119,775,812 F303I probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp788 A T 7: 41,649,640 I567F probably damaging Het
Zfyve26 A G 12: 79,246,087 V2096A probably damaging Het
Other mutations in Ankrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ankrd12 APN 17 65986174 missense probably benign
IGL00555:Ankrd12 APN 17 65984976 missense probably benign 0.09
IGL00790:Ankrd12 APN 17 65984180 missense probably benign
IGL00808:Ankrd12 APN 17 65983965 missense probably benign 0.03
IGL01355:Ankrd12 APN 17 65970340 splice site probably benign
IGL01707:Ankrd12 APN 17 65984278 missense probably damaging 0.98
IGL02045:Ankrd12 APN 17 65986249 missense probably benign 0.17
IGL02125:Ankrd12 APN 17 65970144 utr 3 prime probably benign
IGL02292:Ankrd12 APN 17 66042587 missense probably damaging 0.99
IGL02376:Ankrd12 APN 17 66042529 intron probably benign
IGL02435:Ankrd12 APN 17 65987156 missense probably damaging 1.00
IGL02530:Ankrd12 APN 17 65984403 missense probably benign 0.20
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0048:Ankrd12 UTSW 17 65984803 missense probably damaging 1.00
R0094:Ankrd12 UTSW 17 65970176 missense probably damaging 1.00
R0195:Ankrd12 UTSW 17 66049948 splice site probably null
R0227:Ankrd12 UTSW 17 65987227 missense probably benign 0.00
R0363:Ankrd12 UTSW 17 65985681 missense probably damaging 1.00
R0366:Ankrd12 UTSW 17 65984506 missense possibly damaging 0.93
R0376:Ankrd12 UTSW 17 66053009 missense probably damaging 0.98
R0470:Ankrd12 UTSW 17 65986134 missense probably benign 0.00
R0480:Ankrd12 UTSW 17 66049828 missense possibly damaging 0.47
R0538:Ankrd12 UTSW 17 66049852 missense probably damaging 1.00
R0883:Ankrd12 UTSW 17 65985132 missense probably benign 0.19
R1181:Ankrd12 UTSW 17 66042574 missense probably benign 0.36
R1386:Ankrd12 UTSW 17 65983380 missense possibly damaging 0.94
R1476:Ankrd12 UTSW 17 65986305 missense probably damaging 0.99
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1574:Ankrd12 UTSW 17 65986274 missense probably benign 0.08
R1602:Ankrd12 UTSW 17 65983688 nonsense probably null
R1728:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1729:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1784:Ankrd12 UTSW 17 65984076 missense probably benign 0.01
R1795:Ankrd12 UTSW 17 65986227 missense possibly damaging 0.89
R1901:Ankrd12 UTSW 17 65986703 missense possibly damaging 0.58
R1929:Ankrd12 UTSW 17 65986686 missense possibly damaging 0.55
R1952:Ankrd12 UTSW 17 66031571 missense probably damaging 0.98
R1997:Ankrd12 UTSW 17 65984884 missense probably damaging 1.00
R3612:Ankrd12 UTSW 17 65983547 missense probably benign 0.01
R3768:Ankrd12 UTSW 17 65985720 missense probably benign
R3909:Ankrd12 UTSW 17 65984005 missense probably benign 0.05
R3945:Ankrd12 UTSW 17 65976103 missense probably damaging 1.00
R4176:Ankrd12 UTSW 17 66027366 missense probably damaging 1.00
R4461:Ankrd12 UTSW 17 65985937 unclassified probably null
R4628:Ankrd12 UTSW 17 65985994 missense probably benign
R4726:Ankrd12 UTSW 17 65970324 missense probably damaging 1.00
R4785:Ankrd12 UTSW 17 65982999 missense probably damaging 1.00
R4828:Ankrd12 UTSW 17 65984637 missense probably damaging 0.99
R4847:Ankrd12 UTSW 17 66024092 missense probably benign 0.14
R4858:Ankrd12 UTSW 17 66031433 missense probably damaging 1.00
R5344:Ankrd12 UTSW 17 66049848 missense probably damaging 1.00
R5749:Ankrd12 UTSW 17 65986096 missense probably benign 0.02
R7132:Ankrd12 UTSW 17 65983247 missense probably benign
R7205:Ankrd12 UTSW 17 65985165 missense probably damaging 1.00
R7379:Ankrd12 UTSW 17 65985247 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTGACGTTTGCCCCTAAAC -3'
(R):5'- CCCCTCCAGTAACCATGATTACATTAG -3'

Sequencing Primer
(F):5'- GACGTTTGCCCCTAAACTAATTAAC -3'
(R):5'- AGCATTATTAGTTAGCTAGGTTTCTG -3'
Posted On2014-10-02