Incidental Mutation 'R2207:Fbn2'
ID239198
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 040209-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R2207 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58081399 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 900 (C900*)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect probably null
Transcript: ENSMUST00000025497
AA Change: C900*
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: C900*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,106 V300A probably benign Het
2410137M14Rik A G 17: 36,978,073 probably benign Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abcb1b C T 5: 8,824,803 R488C probably benign Het
Adam34 T C 8: 43,652,237 I124V probably benign Het
Aicda T A 6: 122,561,285 V134D possibly damaging Het
Akt2 T A 7: 27,637,200 probably null Het
Aldh1a3 T C 7: 66,406,021 R341G probably damaging Het
Ankrd12 G T 17: 66,031,574 probably null Het
Anxa11 A G 14: 25,874,297 Y244C probably damaging Het
Atp2c2 G A 8: 119,748,309 R551Q probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bcl11a G T 11: 24,163,343 G229W probably damaging Het
Brip1 A G 11: 86,061,877 V1026A probably benign Het
Cacna1h A T 17: 25,385,013 S1282T probably benign Het
Calcr T C 6: 3,717,133 Y109C probably damaging Het
Ccdc39 T C 3: 33,836,733 I241V probably damaging Het
Ccdc9 A G 7: 16,284,269 probably benign Het
Cdk17 G A 10: 93,228,762 D298N probably damaging Het
Cdkl3 A G 11: 52,027,193 *354W probably null Het
Celf6 A T 9: 59,604,327 Y401F possibly damaging Het
Clec4a4 C T 6: 123,013,807 L169F probably damaging Het
Col14a1 T C 15: 55,463,686 F1411L unknown Het
Col4a2 G T 8: 11,443,352 G1354W probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cst13 A T 2: 148,823,282 R66W probably damaging Het
Dhx8 A G 11: 101,750,971 T632A probably benign Het
Disp1 A G 1: 183,088,342 F838S possibly damaging Het
Dlg1 A G 16: 31,853,846 H599R probably benign Het
Dnah12 T A 14: 26,781,787 V1654E probably damaging Het
Dnah5 C T 15: 28,343,671 L2406F probably benign Het
Fam98b C G 2: 117,267,819 R257G probably damaging Het
Fgf1 A G 18: 38,847,085 Y79H possibly damaging Het
Foxn1 C A 11: 78,358,804 A632S probably benign Het
Fsip2 T G 2: 82,977,479 S1381A probably benign Het
Gtf2b G A 3: 142,778,320 G85D probably benign Het
Gyg C A 3: 20,150,539 G161C probably damaging Het
Hemgn G T 4: 46,396,301 L312I possibly damaging Het
Hic2 T C 16: 17,257,460 M51T possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hpx C T 7: 105,592,426 R287H probably damaging Het
Igf2bp3 C T 6: 49,088,554 G468E possibly damaging Het
Il5ra C A 6: 106,712,441 E397* probably null Het
Itfg1 A T 8: 85,776,198 S246R probably benign Het
Kdm2a A T 19: 4,362,870 D29E probably damaging Het
Lamc2 T G 1: 153,133,706 E784D possibly damaging Het
Lrp2 A T 2: 69,467,028 N3196K possibly damaging Het
Lyzl1 T A 18: 4,181,962 C96* probably null Het
Maf1 A G 15: 76,352,518 T17A probably benign Het
Map1b T C 13: 99,431,083 D1710G unknown Het
Megf8 C T 7: 25,349,797 T1773I probably damaging Het
Mei1 T C 15: 82,103,249 M414T probably benign Het
Myo15 A G 11: 60,506,034 N2643S probably benign Het
Ndufa9 A G 6: 126,844,809 Y64H probably damaging Het
Neb A T 2: 52,211,567 L4354* probably null Het
Nom1 T A 5: 29,439,974 I480N probably damaging Het
Nrxn3 C T 12: 89,348,312 T331M probably damaging Het
Olfr1307 A C 2: 111,944,925 F177C probably damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr403 G T 11: 74,196,324 V274L possibly damaging Het
Olfr643 A G 7: 104,059,405 S66P probably damaging Het
Pcdhb15 A T 18: 37,475,022 T436S probably benign Het
Pcdhb18 T A 18: 37,491,289 N557K probably damaging Het
Pcdhb6 T C 18: 37,335,580 M518T probably benign Het
Pgm2l1 T A 7: 100,268,112 probably null Het
Pih1d2 C A 9: 50,621,079 H162N probably benign Het
Pitrm1 T A 13: 6,569,291 Y721N probably damaging Het
Pla2r1 C A 2: 60,458,435 V618F probably damaging Het
Plb1 T C 5: 32,316,640 S599P possibly damaging Het
Prkg1 T C 19: 30,578,860 D562G probably damaging Het
Proser1 T G 3: 53,478,391 S565A probably benign Het
Prx T A 7: 27,516,788 V238E probably damaging Het
Psapl1 T C 5: 36,205,165 I367T probably damaging Het
Rc3h1 T C 1: 160,940,025 V128A probably damaging Het
Rrm1 T A 7: 102,442,026 M1K probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsl1 A G 13: 67,182,828 T447A probably benign Het
Ryr2 A G 13: 11,810,937 S552P probably damaging Het
Sbf1 A G 15: 89,306,693 S225P possibly damaging Het
Serpina3c T A 12: 104,151,498 I194F probably benign Het
Setd3 C T 12: 108,107,285 V578M probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc6a1 T A 6: 114,308,671 V356E probably damaging Het
Slfn1 A G 11: 83,121,166 E36G possibly damaging Het
Sorcs1 T C 19: 50,230,217 H609R possibly damaging Het
Spag16 A G 1: 70,724,884 H621R probably benign Het
Tg G A 15: 66,681,939 G401D probably benign Het
Tnxb A C 17: 34,709,417 T2602P possibly damaging Het
Trip11 T C 12: 101,873,442 N1643S probably benign Het
Ttn G A 2: 76,879,343 R1581* probably null Het
Ttn A T 2: 76,965,811 I590K probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Wdr7 T A 18: 63,777,607 V690E possibly damaging Het
Xaf1 A T 11: 72,303,402 E36D possibly damaging Het
Zfp131 A T 13: 119,775,812 F303I probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp788 A T 7: 41,649,640 I567F probably damaging Het
Zfyve26 A G 12: 79,246,087 V2096A probably damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGACAGCCTAGCCGTTTTC -3'
(R):5'- GCACATGTCAGTCTTTTCAAAGAAC -3'

Sequencing Primer
(F):5'- ACCACTTAGGACACACTGTGAG -3'
(R):5'- TTGTCTGCCGAGAGAAGA -3'
Posted On2014-10-02