Incidental Mutation 'R0183:Eaf1'
ID23920
Institutional Source Beutler Lab
Gene Symbol Eaf1
Ensembl Gene ENSMUSG00000021890
Gene NameELL associated factor 1
Synonyms4933403C17Rik
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0183 (G1)
Quality Score221
Status Not validated
Chromosome14
Chromosomal Location31494399-31509858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31495315 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 16 (L16Q)
Ref Sequence ENSEMBL: ENSMUSP00000022446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022446] [ENSMUST00000055303] [ENSMUST00000227595] [ENSMUST00000227777] [ENSMUST00000228181] [ENSMUST00000228727] [ENSMUST00000228943]
Predicted Effect probably damaging
Transcript: ENSMUST00000022446
AA Change: L16Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022446
Gene: ENSMUSG00000021890
AA Change: L16Q

DomainStartEndE-ValueType
Pfam:EAF 14 114 3.4e-26 PFAM
low complexity region 125 153 N/A INTRINSIC
low complexity region 188 211 N/A INTRINSIC
low complexity region 218 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055303
SMART Domains Protein: ENSMUSP00000077138
Gene: ENSMUSG00000021891

DomainStartEndE-ValueType
Pfam:Methyltransf_23 49 241 3.3e-13 PFAM
Pfam:Methyltransf_31 77 215 5.1e-9 PFAM
Pfam:Methyltransf_18 79 190 5.8e-10 PFAM
Pfam:Methyltransf_12 84 183 5.9e-17 PFAM
Pfam:Methyltransf_11 84 187 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227595
Predicted Effect probably benign
Transcript: ENSMUST00000227777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227852
Predicted Effect probably benign
Transcript: ENSMUST00000228181
Predicted Effect probably benign
Transcript: ENSMUST00000228727
Predicted Effect probably benign
Transcript: ENSMUST00000228943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228952
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Eaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Eaf1 APN 14 31504526 splice site probably null
IGL01380:Eaf1 APN 14 31497810 unclassified probably benign
IGL02151:Eaf1 APN 14 31497787 missense probably damaging 1.00
IGL02512:Eaf1 APN 14 31497786 missense possibly damaging 0.92
R3715:Eaf1 UTSW 14 31502445 missense possibly damaging 0.94
R4639:Eaf1 UTSW 14 31504376 missense probably benign 0.01
R7346:Eaf1 UTSW 14 31494820 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGACCAGAAAACTGTGGGCTGC -3'
(R):5'- TCGAAGTTCCAGAGGCTAAGGGATG -3'

Sequencing Primer
(F):5'- AGTGCAGCGGCCTTACTTC -3'
(R):5'- TGAGAGGTAAGGAAAGCGAC -3'
Posted On2013-04-16