Incidental Mutation 'R0183:Spef2'
ID23926
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0183 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9716359 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 323 (D323E)
Ref Sequence ENSEMBL: ENSMUSP00000146967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]
Predicted Effect probably benign
Transcript: ENSMUST00000041840
AA Change: D323E

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: D323E

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159093
AA Change: D380E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: D380E

DomainStartEndE-ValueType
Pfam:DUF1042 5 166 3.5e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159288
AA Change: D323E

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: D323E

DomainStartEndE-ValueType
Pfam:CH_2 5 102 3.1e-25 PFAM
low complexity region 106 115 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 602 789 8.8e-11 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1221 N/A INTRINSIC
low complexity region 1264 1278 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
SCOP:d1rec__ 1378 1530 3e-3 SMART
low complexity region 1605 1624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159368
AA Change: D323E

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: D323E

DomainStartEndE-ValueType
Pfam:DUF1042 5 162 1.4e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160236
AA Change: D323E

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: D323E

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162780
AA Change: D380E

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: D380E

DomainStartEndE-ValueType
Pfam:DUF1042 5 164 1.1e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: D323E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gcnt1 C T 19: 17,329,117 D415N probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATAGGCaagtccattgggtgt -3'
(R):5'- ACTGACTTCTGAGCCACTGGGTAA -3'

Sequencing Primer
(F):5'- tgacaagcacgaacagagac -3'
(R):5'- CCACTGGGTAATATGAGCTTGAC -3'
Posted On2013-04-16