Mutagenetix > Incidental Mutation

Incidental Mutation 'R0183:Taf2'

23928

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

150kDa, TAFII150, CIF150, 4732460C16Rik, TAF2B

MMRRC Submission

038448-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0183 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

54878527-54935548 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54919186 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 396 (K396N)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041733
AA Change: K396N

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: K396N

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226864

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227254

Meta Mutation Damage Score

0.1254

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

84% (42/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	C	T	5: 77,034,082 (GRCm39)	D490N	probably benign	Het
Aatf	A	T	11: 84,401,251 (GRCm39)		probably null	Het
Amer3	T	A	1: 34,626,838 (GRCm39)	I359K	probably damaging	Het
Appl1	A	T	14: 26,684,811 (GRCm39)	D79E	probably damaging	Het
Ass1	A	T	2: 31,404,831 (GRCm39)	N371Y	probably damaging	Het
Baz1a	T	A	12: 54,958,172 (GRCm39)	E1026D	probably damaging	Het
Bcl2	G	A	1: 106,640,292 (GRCm39)	R107C	probably damaging	Het
Card14	C	T	11: 119,217,524 (GRCm39)	R386C	probably damaging	Het
Cenpb	T	C	2: 131,020,373 (GRCm39)		probably benign	Het
Clcn4	G	A	7: 7,298,090 (GRCm39)	Q40*	probably null	Het
Clec16a	T	C	16: 10,377,886 (GRCm39)	Y28H	probably damaging	Het
Cul4a	T	C	8: 13,183,790 (GRCm39)	S393P	probably damaging	Het
Dcbld2	A	G	16: 58,265,722 (GRCm39)	D194G	possibly damaging	Het
Dnah6	C	T	6: 73,059,906 (GRCm39)	V2841I	probably damaging	Het
Eaf1	T	A	14: 31,217,272 (GRCm39)	L16Q	probably damaging	Het
Eef1e1	C	T	13: 38,840,162 (GRCm39)	A48T	probably damaging	Het
Exoc3l	C	A	8: 106,021,932 (GRCm39)	R57L	probably damaging	Het
Faf1	A	G	4: 109,792,807 (GRCm39)	N593S	probably benign	Het
Fosb	A	G	7: 19,041,310 (GRCm39)	I61T	probably damaging	Het
Fstl5	A	C	3: 76,229,579 (GRCm39)	I127L	possibly damaging	Het
Gas2l2	T	A	11: 83,319,882 (GRCm39)	M125L	probably benign	Het
Gcnt1	C	T	19: 17,306,481 (GRCm39)	D415N	probably benign	Het
Gtpbp4	A	G	13: 9,024,997 (GRCm39)	M531T	probably benign	Het
Gucy1b2	T	A	14: 62,656,589 (GRCm39)	K256M	probably damaging	Het
Igf2bp2	A	T	16: 21,897,480 (GRCm39)	Y244*	probably null	Het
Jkamp	T	C	12: 72,140,809 (GRCm39)	I118T	possibly damaging	Het
Kalrn	A	T	16: 33,991,749 (GRCm39)		probably null	Het
Kcnma1	A	T	14: 23,558,120 (GRCm39)	D317E	probably damaging	Het
Lipo2	A	T	19: 33,726,951 (GRCm39)		probably null	Het
Lrig3	T	A	10: 125,846,061 (GRCm39)	I830K	probably damaging	Het
Map3k4	A	G	17: 12,454,015 (GRCm39)	I1429T	probably damaging	Het
Mkks	G	A	2: 136,722,606 (GRCm39)	L184F	probably benign	Het
Mmp19	C	T	10: 128,634,872 (GRCm39)	T424I	possibly damaging	Het
Mrps23	A	G	11: 88,100,980 (GRCm39)	E57G	probably damaging	Het
Myh7	T	C	14: 55,216,333 (GRCm39)	T1282A	probably benign	Het
Or2y10	A	G	11: 49,455,675 (GRCm39)	D309G	probably benign	Het
Or8k1	T	A	2: 86,047,173 (GRCm39)	S294C	probably damaging	Het
Phf19	T	C	2: 34,801,214 (GRCm39)	N75S	probably damaging	Het
Pink1	T	G	4: 138,041,490 (GRCm39)	H477P	probably damaging	Het
Ppp6r2	G	A	15: 89,169,990 (GRCm39)	C835Y	probably damaging	Het
Prkcq	T	C	2: 11,257,973 (GRCm39)	I295T	probably damaging	Het
Ptpn13	T	C	5: 103,664,274 (GRCm39)	S421P	probably benign	Het
Ptpn6	A	G	6: 124,705,914 (GRCm39)	S77P	probably damaging	Het
Ptpre	G	T	7: 135,271,574 (GRCm39)	M389I	probably benign	Het
Ranbp9	T	C	13: 43,578,599 (GRCm39)	D158G	probably damaging	Het
Sec14l3	C	T	11: 4,025,547 (GRCm39)	S357L	probably benign	Het
Slc1a6	A	G	10: 78,627,067 (GRCm39)	T135A	probably damaging	Het
Spef2	A	T	15: 9,716,445 (GRCm39)	D323E	possibly damaging	Het
Tcf12	A	T	9: 71,824,309 (GRCm39)	V94E	probably damaging	Het
Trim24	T	A	6: 37,920,415 (GRCm39)	I404N	possibly damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	54,934,845 (GRCm39)	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	54,919,246 (GRCm39)	nonsense	probably null
IGL00549:Taf2	APN	15	54,894,511 (GRCm39)	missense	probably benign	0.03
IGL00839:Taf2	APN	15	54,909,174 (GRCm39)	nonsense	probably null
IGL01089:Taf2	APN	15	54,879,977 (GRCm39)	missense	probably benign
IGL01305:Taf2	APN	15	54,911,670 (GRCm39)	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	54,912,882 (GRCm39)	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	54,923,412 (GRCm39)	missense	probably benign	0.03
IGL02324:Taf2	APN	15	54,891,772 (GRCm39)	missense	probably benign
IGL02328:Taf2	APN	15	54,891,772 (GRCm39)	missense	probably benign
IGL02405:Taf2	APN	15	54,897,551 (GRCm39)	splice site	probably benign
IGL02671:Taf2	APN	15	54,897,572 (GRCm39)	missense	probably benign	0.01
IGL02832:Taf2	APN	15	54,879,959 (GRCm39)	missense	probably benign	0.01
IGL03105:Taf2	APN	15	54,909,195 (GRCm39)	missense	probably benign	0.26
IGL03118:Taf2	APN	15	54,915,559 (GRCm39)	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	54,911,670 (GRCm39)	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	54,901,734 (GRCm39)	missense	probably benign	0.02
R0104:Taf2	UTSW	15	54,901,734 (GRCm39)	missense	probably benign	0.02
R0326:Taf2	UTSW	15	54,910,856 (GRCm39)	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	54,909,325 (GRCm39)	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	54,928,078 (GRCm39)	missense	probably benign	0.02
R0562:Taf2	UTSW	15	54,885,584 (GRCm39)	splice site	probably benign
R0609:Taf2	UTSW	15	54,923,446 (GRCm39)	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	54,901,690 (GRCm39)	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	54,926,461 (GRCm39)	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R0898:Taf2	UTSW	15	54,923,480 (GRCm39)	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	54,894,553 (GRCm39)	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1145:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1145:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1160:Taf2	UTSW	15	54,934,793 (GRCm39)	missense	probably benign	0.01
R1376:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1388:Taf2	UTSW	15	54,900,021 (GRCm39)	missense	probably benign	0.00
R1416:Taf2	UTSW	15	54,901,806 (GRCm39)	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	54,923,311 (GRCm39)	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	54,925,568 (GRCm39)	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	54,879,850 (GRCm39)	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	54,934,793 (GRCm39)	missense	probably benign	0.01
R2090:Taf2	UTSW	15	54,879,882 (GRCm39)	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	54,928,042 (GRCm39)	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	54,915,643 (GRCm39)	missense	probably benign	0.03
R4073:Taf2	UTSW	15	54,915,633 (GRCm39)	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	54,922,276 (GRCm39)	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	54,922,276 (GRCm39)	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	54,922,276 (GRCm39)	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	54,929,364 (GRCm39)	missense	probably benign	0.02
R4937:Taf2	UTSW	15	54,890,619 (GRCm39)	nonsense	probably null
R5082:Taf2	UTSW	15	54,923,441 (GRCm39)	missense	probably benign	0.41
R5335:Taf2	UTSW	15	54,909,136 (GRCm39)	missense	probably benign	0.14
R5383:Taf2	UTSW	15	54,912,815 (GRCm39)	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	54,923,335 (GRCm39)	missense	probably benign	0.01
R5862:Taf2	UTSW	15	54,911,719 (GRCm39)	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	54,901,818 (GRCm39)	missense	probably benign	0.00
R5908:Taf2	UTSW	15	54,935,402 (GRCm39)	unclassified	probably benign
R6033:Taf2	UTSW	15	54,922,297 (GRCm39)	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	54,922,297 (GRCm39)	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	54,926,440 (GRCm39)	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	54,928,026 (GRCm39)	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	54,923,482 (GRCm39)	missense	probably benign	0.27
R7174:Taf2	UTSW	15	54,912,135 (GRCm39)	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	54,925,537 (GRCm39)	missense	probably benign	0.01
R7561:Taf2	UTSW	15	54,919,229 (GRCm39)	missense	probably benign	0.16
R7583:Taf2	UTSW	15	54,928,072 (GRCm39)	nonsense	probably null
R7818:Taf2	UTSW	15	54,929,326 (GRCm39)	missense	probably benign
R7905:Taf2	UTSW	15	54,910,828 (GRCm39)	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	54,912,097 (GRCm39)	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	54,928,013 (GRCm39)	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	54,928,013 (GRCm39)	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	54,894,526 (GRCm39)	missense	probably benign	0.00
R8127:Taf2	UTSW	15	54,923,384 (GRCm39)	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	54,923,384 (GRCm39)	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	54,923,384 (GRCm39)	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	54,929,361 (GRCm39)	nonsense	probably null
R8290:Taf2	UTSW	15	54,926,416 (GRCm39)	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	54,910,849 (GRCm39)	missense	probably benign	0.16
R8832:Taf2	UTSW	15	54,928,001 (GRCm39)	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	54,899,931 (GRCm39)	missense	probably benign	0.26
R8937:Taf2	UTSW	15	54,910,849 (GRCm39)	missense	probably benign	0.16
R9006:Taf2	UTSW	15	54,909,301 (GRCm39)	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R9240:Taf2	UTSW	15	54,926,464 (GRCm39)	missense	probably null	1.00
R9257:Taf2	UTSW	15	54,929,409 (GRCm39)	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	54,911,667 (GRCm39)	missense	probably benign	0.05
R9762:Taf2	UTSW	15	54,894,440 (GRCm39)	critical splice donor site	probably null
R9766:Taf2	UTSW	15	54,910,881 (GRCm39)	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	54,910,832 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTTCCCCACGGAAGACTTGGAAAC -3'
(R):5'- ACCCAGATGTGACGAAGGCTAGATG -3'

Sequencing Primer
(F):5'- ggaactcagaggggcaac -3'
(R):5'- TTGCCTAAAAACAGCAGTGGTC -3'

Posted On

2013-04-16