Incidental Mutation 'R2210:Unc5d'
ID239317
Institutional Source Beutler Lab
Gene Symbol Unc5d
Ensembl Gene ENSMUSG00000063626
Gene Nameunc-5 netrin receptor D
SynonymsUnc5h4, D930029E11Rik
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location28646717-29219636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28761797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 216 (I216T)
Ref Sequence ENSEMBL: ENSMUSP00000148236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168630] [ENSMUST00000209401] [ENSMUST00000210298] [ENSMUST00000210785] [ENSMUST00000211448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168630
AA Change: I216T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128521
Gene: ENSMUSG00000063626
AA Change: I216T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1cs6a2 52 146 5e-3 SMART
IGc2 169 236 2.66e-8 SMART
TSP1 253 304 2.29e-13 SMART
TSP1 309 358 6.33e-7 SMART
transmembrane domain 383 405 N/A INTRINSIC
Pfam:ZU5 545 642 1.6e-33 PFAM
DEATH 850 941 4.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209401
AA Change: I216T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210298
AA Change: I216T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210785
AA Change: I216T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211448
AA Change: I216T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice exhibit impaired induced growth cone collapse response and accelerated radial migration of cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Other mutations in Unc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Unc5d APN 8 28719826 missense probably damaging 0.97
IGL00687:Unc5d APN 8 28715813 splice site probably benign
IGL00970:Unc5d APN 8 28696428 missense probably benign 0.15
IGL01992:Unc5d APN 8 28652791 missense probably damaging 0.98
IGL02024:Unc5d APN 8 28652827 missense probably benign 0.08
IGL02080:Unc5d APN 8 28891288 splice site probably null
IGL02902:Unc5d APN 8 28875606 missense probably damaging 1.00
IGL02982:Unc5d APN 8 28652853 missense probably damaging 1.00
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0761:Unc5d UTSW 8 28696532 intron probably null
R0941:Unc5d UTSW 8 28759027 missense possibly damaging 0.85
R1086:Unc5d UTSW 8 28875630 missense possibly damaging 0.87
R1625:Unc5d UTSW 8 28683206 missense probably damaging 1.00
R1635:Unc5d UTSW 8 28760749 missense probably benign 0.14
R1682:Unc5d UTSW 8 28759081 missense probably damaging 1.00
R1698:Unc5d UTSW 8 28696478 missense probably damaging 0.99
R2015:Unc5d UTSW 8 28758979 missense probably damaging 1.00
R2132:Unc5d UTSW 8 28875529 missense possibly damaging 0.50
R2174:Unc5d UTSW 8 28694540 missense probably damaging 0.99
R3684:Unc5d UTSW 8 28694592 missense probably damaging 1.00
R3734:Unc5d UTSW 8 28761798 missense probably benign 0.02
R4093:Unc5d UTSW 8 28844837 missense possibly damaging 0.87
R4287:Unc5d UTSW 8 28719796 missense probably benign 0.00
R4888:Unc5d UTSW 8 28666899 missense probably benign 0.02
R5000:Unc5d UTSW 8 28715747 missense possibly damaging 0.90
R5060:Unc5d UTSW 8 28719695 missense probably benign 0.00
R5076:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
R5696:Unc5d UTSW 8 28666842 missense probably benign 0.06
R6024:Unc5d UTSW 8 28875511 missense possibly damaging 0.96
R6077:Unc5d UTSW 8 28675307 missense possibly damaging 0.94
R6259:Unc5d UTSW 8 28666792 missense probably benign 0.00
R6387:Unc5d UTSW 8 28875526 nonsense probably null
X0058:Unc5d UTSW 8 28760730 missense probably benign 0.12
X0060:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCCCTGGGAAGTTTTAATACAGTAC -3'
(R):5'- AGAAGCAAGTTCAGCACACTTC -3'

Sequencing Primer
(F):5'- ACAGTACATGGCTCTCTAAATCTCTG -3'
(R):5'- TGCTGTTCCCAGAAGAGA -3'
Posted On2014-10-15