Incidental Mutation 'R2210:Triml2'
ID239318
Institutional Source Beutler Lab
Gene Symbol Triml2
Ensembl Gene ENSMUSG00000091490
Gene Nametripartite motif family-like 2
SynonymsEG622117
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43180541-43193881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43183360 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 61 (Y61H)
Ref Sequence ENSEMBL: ENSMUSP00000148196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163869] [ENSMUST00000209200] [ENSMUST00000209872] [ENSMUST00000210136]
Predicted Effect probably damaging
Transcript: ENSMUST00000163869
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132971
Gene: ENSMUSG00000091490
AA Change: Y61H

DomainStartEndE-ValueType
Pfam:zf-B_box 13 51 7e-7 PFAM
PRY 242 294 2.86e-14 SMART
Pfam:SPRY 297 414 2.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209200
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209872
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210136
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211228
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tri-partite motif (TRIM) family of proteins. This protein may be regulated by the tumor suppressor p53 and may regulate p53 through the enhancement of p53 SUMOylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mc4r A T 18: 66,859,395 F216I probably damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Triml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Triml2 APN 8 43187623 missense probably benign 0.00
IGL01919:Triml2 APN 8 43190312 missense probably damaging 1.00
IGL03382:Triml2 APN 8 43193739 missense probably benign 0.00
R0025:Triml2 UTSW 8 43185432 missense probably benign 0.00
R0058:Triml2 UTSW 8 43185269 splice site probably benign
R0058:Triml2 UTSW 8 43185269 splice site probably benign
R0180:Triml2 UTSW 8 43190309 missense probably benign 0.14
R1671:Triml2 UTSW 8 43183743 missense possibly damaging 0.88
R2143:Triml2 UTSW 8 43193511 missense probably damaging 1.00
R3156:Triml2 UTSW 8 43187679 missense probably benign 0.10
R3902:Triml2 UTSW 8 43190360 missense probably benign 0.03
R4981:Triml2 UTSW 8 43187680 missense probably benign 0.10
R6125:Triml2 UTSW 8 43187622 missense probably benign 0.02
R6478:Triml2 UTSW 8 43185128 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACTAGAATGTCCCAAGCGCC -3'
(R):5'- AGGGTTCCCTATCTCAGCTC -3'

Sequencing Primer
(F):5'- CCAAGCCCCAGTTACCTG -3'
(R):5'- CAAACTTGGAGATTCGCCTG -3'
Posted On2014-10-15