Incidental Mutation 'R2210:Mc4r'
ID239337
Institutional Source Beutler Lab
Gene Symbol Mc4r
Ensembl Gene ENSMUSG00000047259
Gene Namemelanocortin 4 receptor
SynonymsFatboy
MMRRC Submission 040212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2210 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location66857715-66860472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66859395 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 216 (F216I)
Ref Sequence ENSEMBL: ENSMUSP00000054776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057942]
Predicted Effect probably damaging
Transcript: ENSMUST00000057942
AA Change: F216I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: F216I

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016L21Rik C G 5: 114,942,289 R28G probably damaging Het
Adgrb1 C T 15: 74,547,704 A798V probably damaging Het
Ash1l G T 3: 89,066,298 D2555Y probably damaging Het
Atr G A 9: 95,907,300 R1503Q probably damaging Het
Cbln3 T A 14: 55,883,926 I88F possibly damaging Het
Cct7 G A 6: 85,459,230 G41D probably damaging Het
Cd1d2 G T 3: 86,987,734 A138S possibly damaging Het
Dct T C 14: 118,043,149 I152V probably benign Het
Dgkq C A 5: 108,660,523 R58L probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Gm4884 A T 7: 41,043,546 E313V possibly damaging Het
Hectd1 A T 12: 51,806,462 I92K probably damaging Het
Icam1 A G 9: 21,019,033 E61G probably damaging Het
Itgb2l C T 16: 96,426,221 V541M possibly damaging Het
Lmtk2 A G 5: 144,147,609 E154G probably damaging Het
Majin C A 19: 6,222,698 H223N possibly damaging Het
Mettl7b T A 10: 128,958,722 K244N probably damaging Het
Muc4 AG AGG 16: 32,755,176 probably null Het
Obscn A T 11: 59,068,087 V3379D probably damaging Het
Olfr948 A T 9: 39,318,793 S274T probably damaging Het
Pde4b A T 4: 102,597,475 N346I probably damaging Het
Pitpnm1 T C 19: 4,105,253 S331P probably damaging Het
Plcb2 T A 2: 118,717,503 I437F probably damaging Het
Pramef17 T A 4: 143,994,219 M51L probably benign Het
Prr12 A G 7: 45,049,351 probably benign Het
Pus7l T G 15: 94,540,292 D224A possibly damaging Het
Sh3pxd2a A G 19: 47,267,343 S1007P possibly damaging Het
Stac G A 9: 111,602,570 P238S probably damaging Het
Tmem107 A G 11: 69,071,270 E45G possibly damaging Het
Triml2 T C 8: 43,183,360 Y61H probably damaging Het
Uba2 T C 7: 34,163,162 D95G probably damaging Het
Ube2d3 T A 3: 135,463,041 D132E probably benign Het
Unc5d A G 8: 28,761,797 I216T probably damaging Het
Other mutations in Mc4r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.01
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.96
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense possibly damaging 0.61
Big_boned UTSW 18 66859488 missense probably damaging 1.00
Cetacean UTSW 18 66859180 nonsense probably null
chubby UTSW 18 66859847 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
southbeach UTSW 18 66859142 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1781:Mc4r UTSW 18 66859847 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
R6161:Mc4r UTSW 18 66859180 nonsense probably null
R6802:Mc4r UTSW 18 66859417 missense probably benign 0.21
R6807:Mc4r UTSW 18 66859856 missense probably damaging 1.00
R6929:Mc4r UTSW 18 66859182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCAGTATGGATTCTGAGGG -3'
(R):5'- GCGGTGGACAGGTATTTCAC -3'

Sequencing Primer
(F):5'- TTCTGAGGGCAAGAGATGTAGAAC -3'
(R):5'- TTTACGCGCTCCAGTACCATAAC -3'
Posted On2014-10-15