Incidental Mutation 'R2211:Dnah7a'
ID239343
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53479773 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 2942 (I2942V)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: I2942V

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: I2942V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 intron probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGACTCACCACTGTGTATC -3'
(R):5'- TTGGTACACAAATCATGTTCGAGG -3'

Sequencing Primer
(F):5'- GACTCACCACTGTGTATCTATTAAC -3'
(R):5'- TACACAAATCATGTTCGAGGCGAAG -3'
Posted On2014-10-15