Incidental Mutation 'R2211:Plekha5'
ID239370
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140525861 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 4 (E4K)
Ref Sequence ENSEMBL: ENSMUSP00000144832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203517] [ENSMUST00000203774] [ENSMUST00000204145] [ENSMUST00000204876]
Predicted Effect probably benign
Transcript: ENSMUST00000087622
AA Change: E113K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: E113K

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203517
AA Change: E113K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: E113K

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203774
AA Change: E4K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144832
Gene: ENSMUSG00000030231
AA Change: E4K

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 477 511 4e-8 BLAST
low complexity region 512 521 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203955
AA Change: E36K
Predicted Effect probably benign
Transcript: ENSMUST00000204145
AA Change: E113K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231
AA Change: E113K

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000204876
AA Change: E4K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231
AA Change: E4K

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACTCATGTTAGGCTAGAATTAG -3'
(R):5'- GCTGATTCAACAGAATACCCATTC -3'

Sequencing Primer
(F):5'- CACCTTTATGCCTGAGGA -3'
(R):5'- TCAACAGAATACCCATTCCCTCATAC -3'
Posted On2014-10-15