Incidental Mutation 'R2211:Ltbp3'
ID239417
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R2211 (G1)
Quality Score219
Status Not validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5753962 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 834 (I834T)
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
Predicted Effect probably benign
Transcript: ENSMUST00000025890
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081496
AA Change: I834T

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: I834T

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
lilia UTSW 19 5747857 critical splice donor site probably null
rapunzel UTSW 19 5753942 nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5752067 missense probably damaging 0.99
PIT4453001:Ltbp3 UTSW 19 5757794 missense probably damaging 0.97
PIT4480001:Ltbp3 UTSW 19 5751226 missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6021:Ltbp3 UTSW 19 5753680 missense probably benign 0.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
R6709:Ltbp3 UTSW 19 5747857 critical splice donor site probably null
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTGTCAAGGGATCGGAGC -3'
(R):5'- ACTACAGTGTGTCAAATAGGTAGAG -3'

Sequencing Primer
(F):5'- ATCGGAGCCGCTGTGAG -3'
(R):5'- GTAGAGAAGAGCTACAGTGTGTC -3'
Posted On2014-10-15