Incidental Mutation 'R2212:Fscn2'
ID239468
Institutional Source Beutler Lab
Gene Symbol Fscn2
Ensembl Gene ENSMUSG00000025380
Gene Namefascin actin-bundling protein 2
SynonymsC630046B20Rik, ahl8
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R2212 (G1)
Quality Score139
Status Not validated
Chromosome11
Chromosomal Location120361534-120368168 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 120361591 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445]
Predicted Effect probably benign
Transcript: ENSMUST00000026445
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152556
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal generation with structural abnormalities of the outer segment and depressed rod and cone ERGs that worsen with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Fscn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Fscn2 APN 11 120367305 missense probably damaging 0.99
IGL01767:Fscn2 APN 11 120367750 missense possibly damaging 0.82
IGL02212:Fscn2 APN 11 120362055 missense probably damaging 1.00
IGL02299:Fscn2 APN 11 120362199 missense probably benign 0.09
IGL02494:Fscn2 APN 11 120362402 missense probably benign 0.02
IGL02716:Fscn2 APN 11 120366724 missense probably benign 0.00
IGL02882:Fscn2 APN 11 120362499 missense probably benign
IGL02986:Fscn2 APN 11 120367350 missense possibly damaging 0.74
ANU74:Fscn2 UTSW 11 120362336 missense probably damaging 1.00
R0277:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0323:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0513:Fscn2 UTSW 11 120361880 missense probably damaging 1.00
R1451:Fscn2 UTSW 11 120362022 missense probably damaging 0.98
R1620:Fscn2 UTSW 11 120366685 missense probably damaging 1.00
R1736:Fscn2 UTSW 11 120368026 missense probably damaging 1.00
R2327:Fscn2 UTSW 11 120366701 missense probably damaging 1.00
R2384:Fscn2 UTSW 11 120366733 missense possibly damaging 0.48
R2397:Fscn2 UTSW 11 120362169 missense probably damaging 1.00
R4624:Fscn2 UTSW 11 120367343 missense probably benign 0.21
R4634:Fscn2 UTSW 11 120367720 missense possibly damaging 0.65
R4784:Fscn2 UTSW 11 120367987 missense possibly damaging 0.82
R5062:Fscn2 UTSW 11 120366749 missense probably damaging 1.00
R5084:Fscn2 UTSW 11 120361860 missense probably damaging 0.96
R5514:Fscn2 UTSW 11 120368032 missense probably damaging 1.00
R5780:Fscn2 UTSW 11 120366668 missense probably benign 0.14
R6073:Fscn2 UTSW 11 120361787 nonsense probably null
R6345:Fscn2 UTSW 11 120362027 missense probably damaging 0.99
R7110:Fscn2 UTSW 11 120366754 missense probably benign 0.19
R7170:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7171:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTGCTGGACATTGACTCTG -3'
(R):5'- CGTTAACAAGGCCAAACTGG -3'

Sequencing Primer
(F):5'- GACTCTGGACTTGGTGCATCC -3'
(R):5'- AACTGGATCTTCAGCACCTGGTG -3'
Posted On2014-10-15