Incidental Mutation 'R2212:3425401B19Rik'
ID239472
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32661602 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 802 (Q802L)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably benign
Transcript: ENSMUST00000096038
AA Change: Q802L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: Q802L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGGCTTTATCACCGGGGTG -3'
(R):5'- AGCTCCTCAGACCAATCCTTTG -3'

Sequencing Primer
(F):5'- GGCCCTGAGTGTGTTGTC -3'
(R):5'- CTTTTGAAGATCAGCAGAAGGTATGC -3'
Posted On2014-10-15