Incidental Mutation 'R2212:Angptl4'
ID239482
Institutional Source Beutler Lab
Gene Symbol Angptl4
Ensembl Gene ENSMUSG00000002289
Gene Nameangiopoietin-like 4
SynonymsFIAF, BK89, NG27, HFARP
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33773750-33781575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33775418 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 401 (I401T)
Ref Sequence ENSEMBL: ENSMUSP00000002360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002360] [ENSMUST00000173869]
Predicted Effect probably damaging
Transcript: ENSMUST00000002360
AA Change: I401T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002360
Gene: ENSMUSG00000002289
AA Change: I401T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 151 N/A INTRINSIC
FBG 187 404 6.6e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173869
SMART Domains Protein: ENSMUSP00000133417
Gene: ENSMUSG00000002289

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174872
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased levels of triglycerides and cholesterol and a lower increase in body fat after exposure to gut microbiota. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Angptl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Angptl4 APN 17 33781268 missense probably damaging 1.00
R0117:Angptl4 UTSW 17 33780802 missense probably damaging 1.00
R1225:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1491:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1932:Angptl4 UTSW 17 33781275 nonsense probably null
R2055:Angptl4 UTSW 17 33780524 splice site probably null
R2959:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R2963:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3877:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3881:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3882:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R4646:Angptl4 UTSW 17 33781299 missense probably benign 0.00
R4660:Angptl4 UTSW 17 33777275 intron probably benign
R6192:Angptl4 UTSW 17 33777041 missense probably benign 0.09
R6591:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R6691:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R7350:Angptl4 UTSW 17 33777110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACGGAAAAGGGGTCCTC -3'
(R):5'- AGTATGGAAACCCAAGACCTTGAC -3'

Sequencing Primer
(F):5'- AAAAGGGGTCCTCCAGTCTCTC -3'
(R):5'- AGACCTTGACCACATCTCCTG -3'
Posted On2014-10-15