Incidental Mutation 'R2213:Eps15'
ID239510
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
MMRRC Submission 040215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2213 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109361220 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 391 (K391E)
Ref Sequence ENSEMBL: ENSMUSP00000135034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030281] [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000176251]
Predicted Effect probably damaging
Transcript: ENSMUST00000030281
AA Change: K77E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030281
Gene: ENSMUSG00000028552
AA Change: K77E

DomainStartEndE-ValueType
SCOP:d1bg1a1 37 178 8e-8 SMART
low complexity region 191 202 N/A INTRINSIC
internal_repeat_1 308 341 5.7e-7 PROSPERO
low complexity region 348 371 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
internal_repeat_1 485 517 5.7e-7 PROSPERO
UIM 538 557 3.32e0 SMART
UIM 564 583 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102729
AA Change: K391E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552
AA Change: K391E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126015
Predicted Effect probably damaging
Transcript: ENSMUST00000132165
AA Change: K391E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552
AA Change: K391E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175776
AA Change: K427E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552
AA Change: K427E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176251
AA Change: K391E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552
AA Change: K391E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T C 13: 4,276,248 D78G probably damaging Het
Anxa1 C T 19: 20,382,875 R124H probably damaging Het
Arhgef4 G A 1: 34,807,149 probably null Het
C87436 G A 6: 86,445,473 V10I probably benign Het
Ces1a G T 8: 93,025,225 P427Q probably damaging Het
Cpm T C 10: 117,659,839 Y78H probably damaging Het
Csmd3 G A 15: 47,820,447 T1663I possibly damaging Het
Cul7 T C 17: 46,651,472 F10L probably damaging Het
Cyp2j5 T C 4: 96,659,615 N130S probably benign Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddb1 T C 19: 10,608,327 L135P probably damaging Het
Dixdc1 A G 9: 50,701,945 S211P probably benign Het
Dnah12 G T 14: 26,739,330 K970N probably benign Het
Fabp9 A G 3: 10,194,800 V51A probably damaging Het
Flg T C 3: 93,293,028 probably benign Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscb A T 12: 64,474,116 I192N possibly damaging Het
Galntl5 A G 5: 25,217,529 I333V probably benign Het
Gcnt3 A T 9: 70,034,707 V193E probably benign Het
Gle1 T C 2: 29,949,301 F535S probably damaging Het
Gm21671 G T 5: 25,953,177 T59K probably benign Het
Gpr87 A T 3: 59,179,044 S347T probably damaging Het
Gstm2 C T 3: 107,986,093 R18H probably damaging Het
H1fnt T A 15: 98,256,338 Q310L unknown Het
Haus6 C T 4: 86,581,992 E927K possibly damaging Het
Hunk A G 16: 90,432,617 N122S probably damaging Het
Itih4 T A 14: 30,890,713 V232E probably damaging Het
Jag1 G T 2: 137,089,892 D586E probably benign Het
Klk1b1 T C 7: 43,970,481 S155P probably damaging Het
Lama1 G T 17: 67,777,034 G1424* probably null Het
Lrp1 T A 10: 127,540,702 N4279I probably damaging Het
Lrrc43 G A 5: 123,503,577 V525I possibly damaging Het
Lrrc4c G A 2: 97,630,471 V481M probably benign Het
Mecr T A 4: 131,853,815 probably null Het
Megf10 T A 18: 57,288,009 Y906* probably null Het
Mpdz A G 4: 81,310,172 F1319L probably damaging Het
Mtf2 A G 5: 108,100,914 E364G possibly damaging Het
Nelfe T A 17: 34,853,883 D160E probably benign Het
Nin A G 12: 70,045,354 L727P probably damaging Het
Npat A G 9: 53,552,381 T155A probably benign Het
Nupl1 T C 14: 60,239,496 D242G probably benign Het
Olfr1251 A T 2: 89,667,547 L113Q probably damaging Het
Pnlip T C 19: 58,673,770 V116A probably benign Het
Prl7a2 T A 13: 27,665,068 L79F probably benign Het
Rbm25 A T 12: 83,676,082 I760L probably benign Het
Rbms3 A T 9: 116,959,466 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps10 C A 17: 27,630,499 probably benign Het
Slc35e4 T C 11: 3,913,159 E10G possibly damaging Het
Smad2 A T 18: 76,304,626 T434S probably damaging Het
Sox30 C T 11: 45,984,852 S477F probably damaging Het
Stat4 A T 1: 52,013,855 D65V probably damaging Het
Strip2 A G 6: 29,931,148 D366G probably damaging Het
Syngap1 C A 17: 26,953,069 R84S probably damaging Het
Synpo2l A G 14: 20,660,666 Y629H probably damaging Het
Taf4 A T 2: 179,935,890 probably null Het
Ttc21a A G 9: 119,940,461 H68R probably benign Het
Txndc8 T A 4: 57,984,199 Q144L probably benign Het
Tyr T G 7: 87,492,878 Q158P probably damaging Het
Uchl3 T A 14: 101,666,670 probably null Het
Vwa5b1 T C 4: 138,604,812 K298R probably benign Het
Wrn T C 8: 33,257,015 N891S probably benign Het
Ylpm1 A G 12: 85,069,718 S2125G probably benign Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1545:Eps15 UTSW 4 109312329 missense probably benign 0.00
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1799:Eps15 UTSW 4 109382837 missense probably damaging 1.00
R1906:Eps15 UTSW 4 109324201 missense possibly damaging 0.89
R1916:Eps15 UTSW 4 109368974 missense probably damaging 1.00
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R4954:Eps15 UTSW 4 109370678 splice site probably null
R5134:Eps15 UTSW 4 109366530 unclassified probably benign
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 utr 5 prime probably null
R6885:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
R7362:Eps15 UTSW 4 109366242 critical splice donor site probably null
R7461:Eps15 UTSW 4 109329725 missense probably damaging 1.00
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAAGTGCTTTAGTCCTCCAATAC -3'
(R):5'- AACGCCTTCATAAAGCAGCTG -3'

Sequencing Primer
(F):5'- TGCTTTAGTCCTCCAATACAAAATAC -3'
(R):5'- CACTAACAAGCAGGCAATGTTTTC -3'
Posted On2014-10-15