Incidental Mutation 'R2213:Vwa5b1'
ID239512
Institutional Source Beutler Lab
Gene Symbol Vwa5b1
Ensembl Gene ENSMUSG00000028753
Gene Namevon Willebrand factor A domain containing 5B1
Synonyms
MMRRC Submission 040215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R2213 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location138565360-138635884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138604812 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 298 (K298R)
Ref Sequence ENSEMBL: ENSMUSP00000030533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030533] [ENSMUST00000105812]
Predicted Effect probably benign
Transcript: ENSMUST00000030533
AA Change: K298R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030533
Gene: ENSMUSG00000028753
AA Change: K298R

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 2e-28 PFAM
Pfam:VIT 15 138 1.5e-7 PFAM
VWA 351 513 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105812
SMART Domains Protein: ENSMUSP00000101438
Gene: ENSMUSG00000028753

DomainStartEndE-ValueType
Pfam:VIT_2 16 93 1.9e-30 PFAM
Pfam:VIT 29 103 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154312
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T C 13: 4,276,248 D78G probably damaging Het
Anxa1 C T 19: 20,382,875 R124H probably damaging Het
Arhgef4 G A 1: 34,807,149 probably null Het
C87436 G A 6: 86,445,473 V10I probably benign Het
Ces1a G T 8: 93,025,225 P427Q probably damaging Het
Cpm T C 10: 117,659,839 Y78H probably damaging Het
Csmd3 G A 15: 47,820,447 T1663I possibly damaging Het
Cul7 T C 17: 46,651,472 F10L probably damaging Het
Cyp2j5 T C 4: 96,659,615 N130S probably benign Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddb1 T C 19: 10,608,327 L135P probably damaging Het
Dixdc1 A G 9: 50,701,945 S211P probably benign Het
Dnah12 G T 14: 26,739,330 K970N probably benign Het
Eps15 A G 4: 109,361,220 K391E probably damaging Het
Fabp9 A G 3: 10,194,800 V51A probably damaging Het
Flg T C 3: 93,293,028 probably benign Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscb A T 12: 64,474,116 I192N possibly damaging Het
Galntl5 A G 5: 25,217,529 I333V probably benign Het
Gcnt3 A T 9: 70,034,707 V193E probably benign Het
Gle1 T C 2: 29,949,301 F535S probably damaging Het
Gm21671 G T 5: 25,953,177 T59K probably benign Het
Gpr87 A T 3: 59,179,044 S347T probably damaging Het
Gstm2 C T 3: 107,986,093 R18H probably damaging Het
H1fnt T A 15: 98,256,338 Q310L unknown Het
Haus6 C T 4: 86,581,992 E927K possibly damaging Het
Hunk A G 16: 90,432,617 N122S probably damaging Het
Itih4 T A 14: 30,890,713 V232E probably damaging Het
Jag1 G T 2: 137,089,892 D586E probably benign Het
Klk1b1 T C 7: 43,970,481 S155P probably damaging Het
Lama1 G T 17: 67,777,034 G1424* probably null Het
Lrp1 T A 10: 127,540,702 N4279I probably damaging Het
Lrrc43 G A 5: 123,503,577 V525I possibly damaging Het
Lrrc4c G A 2: 97,630,471 V481M probably benign Het
Mecr T A 4: 131,853,815 probably null Het
Megf10 T A 18: 57,288,009 Y906* probably null Het
Mpdz A G 4: 81,310,172 F1319L probably damaging Het
Mtf2 A G 5: 108,100,914 E364G possibly damaging Het
Nelfe T A 17: 34,853,883 D160E probably benign Het
Nin A G 12: 70,045,354 L727P probably damaging Het
Npat A G 9: 53,552,381 T155A probably benign Het
Nupl1 T C 14: 60,239,496 D242G probably benign Het
Olfr1251 A T 2: 89,667,547 L113Q probably damaging Het
Pnlip T C 19: 58,673,770 V116A probably benign Het
Prl7a2 T A 13: 27,665,068 L79F probably benign Het
Rbm25 A T 12: 83,676,082 I760L probably benign Het
Rbms3 A T 9: 116,959,466 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps10 C A 17: 27,630,499 probably benign Het
Slc35e4 T C 11: 3,913,159 E10G possibly damaging Het
Smad2 A T 18: 76,304,626 T434S probably damaging Het
Sox30 C T 11: 45,984,852 S477F probably damaging Het
Stat4 A T 1: 52,013,855 D65V probably damaging Het
Strip2 A G 6: 29,931,148 D366G probably damaging Het
Syngap1 C A 17: 26,953,069 R84S probably damaging Het
Synpo2l A G 14: 20,660,666 Y629H probably damaging Het
Taf4 A T 2: 179,935,890 probably null Het
Ttc21a A G 9: 119,940,461 H68R probably benign Het
Txndc8 T A 4: 57,984,199 Q144L probably benign Het
Tyr T G 7: 87,492,878 Q158P probably damaging Het
Uchl3 T A 14: 101,666,670 probably null Het
Wrn T C 8: 33,257,015 N891S probably benign Het
Ylpm1 A G 12: 85,069,718 S2125G probably benign Het
Other mutations in Vwa5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Vwa5b1 APN 4 138581217 missense probably benign 0.08
IGL02133:Vwa5b1 APN 4 138586557 critical splice donor site probably null
IGL02379:Vwa5b1 APN 4 138612859 missense probably damaging 1.00
IGL02671:Vwa5b1 APN 4 138569126 nonsense probably null
IGL02864:Vwa5b1 APN 4 138608975 missense probably benign 0.00
IGL03076:Vwa5b1 APN 4 138600188 missense probably damaging 1.00
IGL03115:Vwa5b1 APN 4 138600149 missense possibly damaging 0.93
IGL03119:Vwa5b1 APN 4 138606541 missense probably benign 0.01
R0114:Vwa5b1 UTSW 4 138608858 nonsense probably null
R0157:Vwa5b1 UTSW 4 138604879 missense probably benign 0.00
R0528:Vwa5b1 UTSW 4 138594351 missense probably damaging 1.00
R0562:Vwa5b1 UTSW 4 138635711 splice site probably benign
R0718:Vwa5b1 UTSW 4 138608824 missense probably damaging 1.00
R1555:Vwa5b1 UTSW 4 138605477 missense probably benign 0.02
R1573:Vwa5b1 UTSW 4 138604873 missense probably damaging 1.00
R1857:Vwa5b1 UTSW 4 138569102 missense probably damaging 1.00
R1883:Vwa5b1 UTSW 4 138575389 missense probably damaging 0.96
R1906:Vwa5b1 UTSW 4 138600236 missense possibly damaging 0.93
R1913:Vwa5b1 UTSW 4 138592020 nonsense probably null
R2121:Vwa5b1 UTSW 4 138588569 missense probably benign 0.00
R2355:Vwa5b1 UTSW 4 138591910 critical splice donor site probably null
R2655:Vwa5b1 UTSW 4 138594303 missense probably damaging 1.00
R4134:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4135:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4635:Vwa5b1 UTSW 4 138610839 missense possibly damaging 0.82
R4773:Vwa5b1 UTSW 4 138581755 missense probably benign 0.01
R4832:Vwa5b1 UTSW 4 138605540 missense probably damaging 1.00
R4906:Vwa5b1 UTSW 4 138610747 missense probably benign 0.03
R4916:Vwa5b1 UTSW 4 138594262 missense possibly damaging 0.81
R4995:Vwa5b1 UTSW 4 138608843 missense probably damaging 1.00
R5573:Vwa5b1 UTSW 4 138608890 missense probably damaging 1.00
R5872:Vwa5b1 UTSW 4 138578651 missense possibly damaging 0.63
R6255:Vwa5b1 UTSW 4 138578672 missense probably benign 0.00
R6811:Vwa5b1 UTSW 4 138592103 missense probably benign 0.00
R6901:Vwa5b1 UTSW 4 138586569 missense probably benign
R7144:Vwa5b1 UTSW 4 138605431 critical splice donor site unknown
R7146:Vwa5b1 UTSW 4 138581612 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGCCACCAGTTTAGGATGTG -3'
(R):5'- TGCAAAGATGGTGGCGCTAG -3'

Sequencing Primer
(F):5'- CACCAGTTTAGGATGTGACCTCAG -3'
(R):5'- GCTGCTTCACATTCAGAGATG -3'
Posted On2014-10-15