Incidental Mutation 'R2213:Prl7a2'
ID239542
Institutional Source Beutler Lab
Gene Symbol Prl7a2
Ensembl Gene ENSMUSG00000046899
Gene Nameprolactin family 7, subfamily a, member 2
SynonymsPLP-F, Prlpf
MMRRC Submission 040215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.032) question?
Stock #R2213 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location27658584-27668036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27665068 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 79 (L79F)
Ref Sequence ENSEMBL: ENSMUSP00000006660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006660]
Predicted Effect probably benign
Transcript: ENSMUST00000006660
AA Change: L79F

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000006660
Gene: ENSMUSG00000046899
AA Change: L79F

DomainStartEndE-ValueType
Pfam:Hormone_1 17 244 6.9e-45 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T C 13: 4,276,248 D78G probably damaging Het
Anxa1 C T 19: 20,382,875 R124H probably damaging Het
Arhgef4 G A 1: 34,807,149 probably null Het
C87436 G A 6: 86,445,473 V10I probably benign Het
Ces1a G T 8: 93,025,225 P427Q probably damaging Het
Cpm T C 10: 117,659,839 Y78H probably damaging Het
Csmd3 G A 15: 47,820,447 T1663I possibly damaging Het
Cul7 T C 17: 46,651,472 F10L probably damaging Het
Cyp2j5 T C 4: 96,659,615 N130S probably benign Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddb1 T C 19: 10,608,327 L135P probably damaging Het
Dixdc1 A G 9: 50,701,945 S211P probably benign Het
Dnah12 G T 14: 26,739,330 K970N probably benign Het
Eps15 A G 4: 109,361,220 K391E probably damaging Het
Fabp9 A G 3: 10,194,800 V51A probably damaging Het
Flg T C 3: 93,293,028 probably benign Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscb A T 12: 64,474,116 I192N possibly damaging Het
Galntl5 A G 5: 25,217,529 I333V probably benign Het
Gcnt3 A T 9: 70,034,707 V193E probably benign Het
Gle1 T C 2: 29,949,301 F535S probably damaging Het
Gm21671 G T 5: 25,953,177 T59K probably benign Het
Gpr87 A T 3: 59,179,044 S347T probably damaging Het
Gstm2 C T 3: 107,986,093 R18H probably damaging Het
H1fnt T A 15: 98,256,338 Q310L unknown Het
Haus6 C T 4: 86,581,992 E927K possibly damaging Het
Hunk A G 16: 90,432,617 N122S probably damaging Het
Itih4 T A 14: 30,890,713 V232E probably damaging Het
Jag1 G T 2: 137,089,892 D586E probably benign Het
Klk1b1 T C 7: 43,970,481 S155P probably damaging Het
Lama1 G T 17: 67,777,034 G1424* probably null Het
Lrp1 T A 10: 127,540,702 N4279I probably damaging Het
Lrrc43 G A 5: 123,503,577 V525I possibly damaging Het
Lrrc4c G A 2: 97,630,471 V481M probably benign Het
Mecr T A 4: 131,853,815 probably null Het
Megf10 T A 18: 57,288,009 Y906* probably null Het
Mpdz A G 4: 81,310,172 F1319L probably damaging Het
Mtf2 A G 5: 108,100,914 E364G possibly damaging Het
Nelfe T A 17: 34,853,883 D160E probably benign Het
Nin A G 12: 70,045,354 L727P probably damaging Het
Npat A G 9: 53,552,381 T155A probably benign Het
Nupl1 T C 14: 60,239,496 D242G probably benign Het
Olfr1251 A T 2: 89,667,547 L113Q probably damaging Het
Pnlip T C 19: 58,673,770 V116A probably benign Het
Rbm25 A T 12: 83,676,082 I760L probably benign Het
Rbms3 A T 9: 116,959,466 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps10 C A 17: 27,630,499 probably benign Het
Slc35e4 T C 11: 3,913,159 E10G possibly damaging Het
Smad2 A T 18: 76,304,626 T434S probably damaging Het
Sox30 C T 11: 45,984,852 S477F probably damaging Het
Stat4 A T 1: 52,013,855 D65V probably damaging Het
Strip2 A G 6: 29,931,148 D366G probably damaging Het
Syngap1 C A 17: 26,953,069 R84S probably damaging Het
Synpo2l A G 14: 20,660,666 Y629H probably damaging Het
Taf4 A T 2: 179,935,890 probably null Het
Ttc21a A G 9: 119,940,461 H68R probably benign Het
Txndc8 T A 4: 57,984,199 Q144L probably benign Het
Tyr T G 7: 87,492,878 Q158P probably damaging Het
Uchl3 T A 14: 101,666,670 probably null Het
Vwa5b1 T C 4: 138,604,812 K298R probably benign Het
Wrn T C 8: 33,257,015 N891S probably benign Het
Ylpm1 A G 12: 85,069,718 S2125G probably benign Het
Other mutations in Prl7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Prl7a2 APN 13 27659208 missense probably damaging 0.98
IGL02424:Prl7a2 APN 13 27667970 missense probably null 0.08
IGL02734:Prl7a2 APN 13 27659207 missense probably benign 0.38
IGL02823:Prl7a2 APN 13 27662751 missense possibly damaging 0.95
R0733:Prl7a2 UTSW 13 27662688 missense probably damaging 1.00
R1371:Prl7a2 UTSW 13 27662767 missense probably benign 0.01
R1778:Prl7a2 UTSW 13 27659271 missense probably damaging 0.98
R1857:Prl7a2 UTSW 13 27659180 nonsense probably null
R2063:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2064:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2065:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2067:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2068:Prl7a2 UTSW 13 27660887 missense probably damaging 0.98
R2176:Prl7a2 UTSW 13 27659106 missense probably benign 0.10
R4111:Prl7a2 UTSW 13 27665067 missense possibly damaging 0.96
R4459:Prl7a2 UTSW 13 27665996 missense probably benign 0.21
R4483:Prl7a2 UTSW 13 27660947 missense possibly damaging 0.80
R4722:Prl7a2 UTSW 13 27660875 missense probably damaging 1.00
R5360:Prl7a2 UTSW 13 27659160 missense probably benign 0.22
R5778:Prl7a2 UTSW 13 27661000 nonsense probably null
R6667:Prl7a2 UTSW 13 27661041 missense probably benign 0.03
R7107:Prl7a2 UTSW 13 27659093 missense not run
Predicted Primers PCR Primer
(F):5'- TGATTTGATGAAGCTGTCCTCTGC -3'
(R):5'- AACAGGAAGGGGTTCTCTGTTTC -3'

Sequencing Primer
(F):5'- AGCTGTCCTCTGCTTTTGAACAG -3'
(R):5'- CTGTTCAGTGTCAGTACATACCAAGG -3'
Posted On2014-10-15