Incidental Mutation 'R2229:Aldh1l1'
List |< first << previous [record 89 of 1871] next >> last >|
ID239595
Institutional Source Beutler Lab
Gene Symbol Aldh1l1
Ensembl Gene ENSMUSG00000030088
Gene Namealdehyde dehydrogenase 1 family, member L1
SynonymsFthfd, 1810048F20Rik
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90486427-90600203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 90583186 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 605 (T605R)
Ref Sequence ENSEMBL: ENSMUSP00000114304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032175] [ENSMUST00000130418] [ENSMUST00000204796]
Predicted Effect probably damaging
Transcript: ENSMUST00000032175
AA Change: T605R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032175
Gene: ENSMUSG00000030088
AA Change: T605R

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 6.9e-53 PFAM
Pfam:Formyl_trans_C 204 310 4e-18 PFAM
Pfam:PP-binding 325 391 3.7e-6 PFAM
Pfam:Aldedh 430 898 1.3e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130418
AA Change: T605R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114304
Gene: ENSMUSG00000030088
AA Change: T605R

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 7.4e-54 PFAM
Pfam:Formyl_trans_C 204 310 2.6e-18 PFAM
Pfam:Aldedh 430 898 1.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204796
SMART Domains Protein: ENSMUSP00000145380
Gene: ENSMUSG00000030088

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 180 3e-53 PFAM
Pfam:Formyl_trans_C 204 310 1.5e-17 PFAM
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Aldh1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Aldh1l1 APN 6 90598380 missense probably damaging 1.00
IGL01350:Aldh1l1 APN 6 90559356 missense probably damaging 1.00
IGL01601:Aldh1l1 APN 6 90591841 missense probably damaging 1.00
IGL01686:Aldh1l1 APN 6 90559233 splice site probably benign
IGL01868:Aldh1l1 APN 6 90583230 nonsense probably null
IGL01941:Aldh1l1 APN 6 90562695 missense probably damaging 0.98
IGL01982:Aldh1l1 APN 6 90559863 missense probably benign 0.00
IGL02088:Aldh1l1 APN 6 90580590 splice site probably benign
IGL02159:Aldh1l1 APN 6 90594656 splice site probably benign
IGL02450:Aldh1l1 APN 6 90569873 missense probably benign 0.00
IGL02657:Aldh1l1 APN 6 90590794 missense probably damaging 1.00
IGL02839:Aldh1l1 APN 6 90569875 missense possibly damaging 0.95
R0149:Aldh1l1 UTSW 6 90589414 missense possibly damaging 0.85
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0206:Aldh1l1 UTSW 6 90569866 missense possibly damaging 0.88
R0418:Aldh1l1 UTSW 6 90569893 missense possibly damaging 0.49
R1121:Aldh1l1 UTSW 6 90589384 missense probably benign
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1467:Aldh1l1 UTSW 6 90571928 missense possibly damaging 0.90
R1649:Aldh1l1 UTSW 6 90564389 missense probably benign
R1793:Aldh1l1 UTSW 6 90577831 missense possibly damaging 0.92
R2043:Aldh1l1 UTSW 6 90557332 missense probably benign 0.05
R2044:Aldh1l1 UTSW 6 90562665 missense probably benign 0.00
R2426:Aldh1l1 UTSW 6 90598284 missense probably damaging 0.99
R4109:Aldh1l1 UTSW 6 90562644 missense probably benign 0.04
R4818:Aldh1l1 UTSW 6 90596915 missense probably benign
R5214:Aldh1l1 UTSW 6 90563417 missense probably damaging 1.00
R5285:Aldh1l1 UTSW 6 90576770 nonsense probably null
R5426:Aldh1l1 UTSW 6 90559299 missense probably benign
R5516:Aldh1l1 UTSW 6 90596945 missense possibly damaging 0.95
R5970:Aldh1l1 UTSW 6 90597046 intron probably benign
R6235:Aldh1l1 UTSW 6 90564457 missense probably benign 0.44
R6322:Aldh1l1 UTSW 6 90562698 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAAGACCTAATTCTCCCTGAG -3'
(R):5'- TAGCCTCCTTAACCACAGGC -3'

Sequencing Primer
(F):5'- CAGTGCCTATGGTTGGCC -3'
(R):5'- CACAGGCTGGTCATGGC -3'
Posted On2014-10-15